What state of matter are the Inner Planets

Answers

Answer 1

Answer:

Solid

Explanation:

The four inner planets are also called "the rocky planets" because of their solid state

Answer 2
It is definitely solid

Related Questions

Where does oceanic and continental crust meet?

Answers

Hello :)
They both meet above the the earths mantle.

If that’s not the answer your looking for please tell me and I will help more. If you have Letter options to choose that have answers. Telling me those answers you have to choose from could help me find the best answer for you
In the mantle I believe

heres free wallpapers and pnts! :)) (phone and PC and chromebook wallpapers) (credits to those who made them !)

Answers

Answer: :DD

Explanation:

Help no link and answer please
11. What tool would help the students get a close look at the rock sample? *
12. What tool would help the students find the mass of the rock sample? *

Answers

Answer:

12. you measure mass with a balnece. such as a triple balence beam or an electronic balance.

i dont know 11 sorry

11. Use a microscope

12. Use a scale .

Lauren's SUV was detected exceeding the posted speed limit of 60 kilometers per hour, how many kilometers per hour over the limit would she have been traveling if she had covered a distance of 10 kilometers in 6 minutes? (6 minutes = 0.1 hr)

Answers

40 mph

this is because if we multiply both by 6, we get 60 and 36 minutes but we cant have 36 minutes since it has to be 60 so we can get mph so we would have to multiply both by 10 makeing the time 60 and the kilometers 100 and 60 minus 100 is 40

Please help meh
Why should you never pick up a hot pot by its metal handle? *
A The handle will be hot because metal is a good conductor of heat.
B The handle will be slippery because metal is slippery when heated.
C The handle will be soft because the metal in cooking pans is easily melted.
D The handle will be freezing cold because metal turns heat to cold.

Answers

Answer:

A : the handle will be hot because metal is a good conductor of heat

Explanation:

B The handle will be slippery because metal is slippery when heated. - there is no evidence of this literally anywhere lol

C The handle will be soft because the metal in cooking pans is easily melted. - cast irons melting degree is 1204°C, so unless your cooking lava or something the handle is not gonna melt

D The handle will be freezing cold because metal turns heat to cold. - No, because the containments of the pot are hot not cold, and metal conducts heat

Answer:

A is the correct answer.

Explanation:

b = false

c = false

d = false

a = true!!!

Please fill in the blank if you don't mind.

Answers

Answer:

is there answer choices?

Explanation:

is there any answers given or is this all in your textbook or lessons?

Write a main idea statement about the nervous system.

Answers

Answer:

The nervous system is the major controlling, regulatory, and communicating system in the body. It is the center of all mental activity including thought, learning, and memory. Together with the endocrine system, the nervous system is responsible for regulating and maintaining homeostasis.

Explanation:

the nervous system helps all parts of the body communicate with each other

Hey I need help w/ this pic below ASAP!!!
Pls will mark brainliest:) Not joking lol

Answers

Where is the picture
There’s no picture…

Plot the stars A-E. Once plotted determine their color and type.

Answers

Answer:

color 1 blue color 2 purple 3 green 4 red 5 i still do not know

Explanation:

What change does this cause concerning weather?

Answers

Answer:

More extreme weather.

Explanation:

The Conveyor Belt of tides functions on a local and global level to spread out the cold and hot temperature differences on the planet. It is a delicate but important process that is easily disrupted, which causes it to slow down. And when it slows down, all those temperature differences will become more concentrated, causing colder places to be colder and hotter places to be hotter, ultimately leading to more extreme weather events as these cold and hot spots collide more violently than before.

Here's a picture I found on it:

More extreme weather <3

PLEASE SOMEONE HELP ME ILL GIVE THE PERSON BRAINLIEST


If a ball was dropped from the Empire State Building, or from the Golden Gate Bridge, or from the Statue of Liberty, and from the top of a table, tell Gravitron how long it would take each of the balls to hit the bottom. Fill in the table below:

Dropped from:

Time (seconds)

Empire State Building



Golden Gate Bridge



Statue of Liberty



Tabletop

Answers

The correct answer is the Golden Gate Bridge

ITS 9:04 AND I ONLY HAVE TILL 10:00 PLEASE HELP FAST!
Classify the forms of energy described in each scenario by filling in the correct term.
A windmill’s blades move from the blowing wind.
The movement of the blades represents______ energy.
The visible light that allows people to see where they are going describes______ energy.

Answers

Answer:

The movement of the blades represents kinetic energy

The visible light that allows people to see where they are going describes light energy

Answer: 1. Kinetic 2. Radiant

Explanation:

Which part of the atom determines the chemical properties and chemical reactivity of an element?

A. The number of valence electrons
B. The total number of electrons
C. The number of neutrons
D. The number of protons

Answers

The answer is will be C

pick 2 not one answer please and thank you

Answers

The answer is B and D I don’t want to explain because these two answers should explain why. If I helped mark me the brainiest!!

Answer:

B and D

Explanation:

Hey people! I sorta need help. :))

Answers

Answer:

1. Attract

2. Repel

3. Attract

4 Repel

always remember when dealing with magnets, Opposites attract

ATTRACT
REPEL
ATTRACT
REPEL

What information is used to determine earthquake risk?

Answers

Answer:

There are several pieces of information that are used to determine earthquake risk:

Seismic data: This includes information about the frequency, size, and location of earthquakes that have occurred in a particular area. This can help scientists understand the likelihood of future earthquakes and how strong they are likely to be.

Geological data: This includes information about the geology of an area, including the types of rocks and soil present, the structure of the Earth's crust, and the presence of fault lines or other features that may affect the likelihood of earthquakes.

Population data: The number of people living in an area can also be a factor in determining earthquake risk, as a larger population is more likely to be affected by an earthquake than a smaller one.

Building data: Information about the types and condition of buildings in an area can also be used to determine earthquake risk, as buildings that are poorly constructed or not designed to withstand earthquakes are more likely to be damaged or collapse.

Insurance data: Insurance companies may also use data about past earthquakes and their effects to help assess the risk of future earthquakes in an area.

Overall, the risk of earthquakes is determined by a combination of these and other factors, and it can vary significantly from one location to another.

Answer:

In order to determine earthquake risk, information on the density of buildings and people (exposure), the vulnerability of the built environment, and robust earthquake hazard assessments, including the impact of local soil conditions, are needed.

Several factors can cause weather patterns in the atmosphere. The
diagram below shows how air movement near the equator can form
thunderstorms.
Using the image below, determine which description correctly explains
which heat transfer is shown and why.

A. decrease in relative humidity loers the temeprature therefore creting
thunderstorms
B. heating by energy from the Sun causes the cooling and waring of air and ocean
currents
C. movement of ocean currents heats the air
D. warming in the upper atmosphere leads to thunderstorms in the troposphere

Answers

Answer:

D. Warming in the upper atmosphere leads to thunderstorms in the troposphere

Explanation:

The image is showing the circulation of air, which is heat rising and cold air falling. Also, thunderstorms occur in the troposphere.

Which of the following could describe the velocity of an object?
50 m/s
50 m east
50 m/s east
50 m/s^2

Answers

Answer:

Explanation:

50 ms east

Yeah it is 50 ms east

10pts} If a ball is thrown straight up into the air with a velocity of 15 m/s. How many seconds will it take for the ball to reach its peak? (Assume no air friction and g = -9.81 m/s²)

Please give the most detailed answer. I need reasoning as well. Brainliest to the person who gives the best answer

Answers

Answer:

-81.2361 m/s

Explanation:

15 m/s                                               15 m/s

- 9.81 m/s^2= 96.2361                      - 96.2361

It will take for the ball to reach its peak 81.2361 m/s if a ball is thrown straight up into the air with a velocity of 15 m/s.

15 m/s                                              

- 9.81 m/s^2= 96.2361            

Which formula has been used for change in velocity?

Use the formula for change in velocity equal the acceleration times the time, considering that the only acceleration acting is that of "g" (g = 9.8 m/s^2). Consider also that at the top of the trajectory is when the velocity becomes zero and the motion changes from upwards to downwards.It takes the tennis ball approximately 0.78 seconds to reach the maximum height.

Calculate the ball's greatest height using the vertically modelling method, h = -16t2 + vt + s, where v is just the initial velocity at feet/second and s is indeed the height in feet.

Zero The ball travels upward when you throw it, but because gravity is pulling on it, its speed diminishes as it ascends.The ball begins to slow down, and during the peak of its journey, it has zero velocity.

Therefore, It will take for the ball to reach its peak 81.2361 m/s if a ball is thrown straight up into the air with a velocity of 15 m/s.

15 m/s                                              

- 9.81 m/s^2= 96.2361        

Learn more about velocity on:

https://brainly.com/question/28738284

#SPJ2

ANSWER As Soon As Possible

Answers

The image is blank

Explanation:

This picture should help with the answer. If helped mark me the brainiest!!

Put them in order need help plz

Answers

Answer:Betelgeuse

Antares

Sirius

Archutus

The sun

Explanation:

I looked on safari

ASAT should be the answer

could someone help me i need the real answers fast

will give brainiest

Answers

Where's the question, it's blank?

Yea it is re put it plz so I can do let me kno when you do

If Neptune’s mass were reduced, what could be done to maintain the same force of gravitational attraction between Neptune and the Sun?

Answers

Make Neptune closer to the sun because then it would have a stronger gravitation pull. Because the closer the objects are, they will have a stronger gravitaional force and when the object has more mass, the gravity is also stronger. So, if the mass is reduced, the gravity force would be reduced, but if you bring neptune closer, the gravity force would increase

helpppppppppppppppppp

Answers

position 2

i know cause i already learned this

Position 22222222222222222

Please help science final test. 6 question 22 points and I will choose brainliest.

1.Where is matter found?
2. Use your five senses to describe hot buttered popcorn. (use all 5 senses) *
3. What property of matter can be observed using a pan of water? *
4. Paper clips are made of steel, which has iron in it. Do you expect paper clips to be attracted or not attracted to a magnet? Why or why not? *
5. What properties of an object would you observe when you use a metric ruler? *
6. What metric unit is used to describe the mass of an object? *

Answers

Answer:

1. Even though matter can be found all over the Universe, you will only find it in a few forms (states) on Earth. We cover five states of matter on the site. Each of those states is sometimes called a phase. There are many other states of matter that exist in extreme environments.

2. hot buttered popcorn, burns my tongue, smells buttery, looks yellowish-white, tastes like butter, and sounds like popping corn.

3. The water is a liquid so it has the same shape had the pan.

4.Paper clips are attracted to magnets because iron has a magnectic force.

5. The first (or smallest measurement) you would see is the hash marking millimeters, which is written as "mm". 1mm equals the thickness of a dime. The unit of measure that is most often displayed on a metric ruler would be centimeters written "cm". 10mm equals 1cm and 2.5cm is about equal to 1 inch. Centimeters are displayed for viewing like inches are, marked on the ruler in increments of 1, 2, 3, 4... and so on. Usually to 30cm which is slightly less than 12 inches.

6. Mass is used to measure the weight of an object. For example, you are measuring the mass of your body when you step on to a scale. In the metric system of measurement, the most common units of mass are the gram and kilogram.

Explanation:

It won’t let me put up all the answers this is part of it

Why is Christchurch, New Zealand’s air temperature cooler than usual during El Nino years?

Answers

Answer:

During normal years energy transfers from the ocean to the air. However, during El Nino years, the current is not as warm, so less energy will transfer from the current to the air, making Christchurch cooler than usual. During El Niño years, the normal prevailing winds are disrupted.

Explanation:

During normal years energy transfers from the ocean to the air. However, during El Nino years, the current is not as warm, so less energy will transfer from the current to the air, making Christchurch cooler than usual. During El Niño years, the normal prevailing winds are disrupted.

Write a report on waves. Some questions you might consider are: What makes a wave? Why are some waves small and some large? How are waves classified? Are there different kinds of waves? What happens when a wave meets the shore? Where in the world do you find the best waves for surfing?

Answers

Answer:

The waves have energy that wave back and forth because the waves are never still, they are always moving. There are different types of waves because sometimes (like a tsunami) the waves are affected by other things like the earth plates. Portugal is one of the best places to surf because they have waves that can reach up to 6 to 15 feet high!

Explanation:

were they right??????

A baseball bat his a baseball with a force of 100 Newtons. What is the force and its direction exerted by the ball on the bat?

Answers

I think it's "100 Newtons in the opposite direction of Net Force Motion".

Yeah it’s 100 Newton’s in the opposite direction and net force motion

How many moles of C02 are needed to fill an 0.125 m3 tank to a pressure of 1330.0 atm at 29.0 C (Celsius)

please include procedure if you can

Answers

Answer:

A temperature of 100.0°C?

Explanation:

The volume of a sample of gas measured at 25.0°C and 1.00 atm pressure is 10.0 ... How many moles are in a gas sample occupying 0.500 I at 170 mmHg and 25° C? ... Which of the following gases would occupy the largest volume at 25°C and ... oxygen, 3.0 mol of nitrogen, and 1.0 mol of carbon dioxide when the total.

Hey hope this helps,
It would be 100.0 C

Harry is pedalling on a stationary bicycle, which lights up a signboard. What energy conversion takes place?

Answers

Answer:

Kinetic to Electrical to Light.

Explanation:

Kinetic energy from Harry will be converted to electrical energy within the bicycle. This electrical energy travels to the signboard, which then lights up, producing light energy.

Kinetic to electrical
Other Questions
Lila swam 50 meters north in 10 seconds. Find Lila's velocity TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets. True/False: Money is more important than finding something you're going to lovedoing. Select the correct answer.Which of these is an example of elemental carbon?A. DiamondB. MethaneC. Proteins 6 less than 3 times a number 42 what is the number Two numbers total 31 and have a difference of 9. Find the two numbers. Can someone help me with this question? Can someone please help me with math. The process by which keys are managed by a third party, such as a trusted CA, is known as?O Key escrowO Key destructionO Key renewalO Key management Which sentence best states the central idea of the account?A After the Civil War, the city of San Antonio prospered.B San Antonio is famous because of the Alamo.C Market Square is a large Mexican marketplace in San Antonio.D San Antonio is a thriving city with a fascinating history. Name the minor arcs in the circle Select all the minor arcs by their correct names. (a+b+c)(a-b+c)=a2+b2+c2 prove A nurse is caring for a patient with SIADH. What severe complication should the nurse assess for?a.Strokeb.Diabetes insipidusc.Neurologic damaged.Renal failure Find the measure of angle A, Find the error with subject-verb agreement. Select the incorrect verb and type it correctly.In Chile's arid Atacama Desert there is areas where any rainfall has yet to berecorded Una onda sonora se produce durante 1,5 s. Posee una longitud de onda de 2,4 m y una velocidad de 340 m/s. a) Cul es la frecuencia de la onda?, Ezra has a hard time sticking with exercise routines. He does well for a few weeks, but then tends to slack off a bit. What would be the BEST way for Ezra to motivate himself to stay on the program that he creates for himself? Read the excerpt from "This World is not Conclusion by Emily Dickinson.This World is not Conclusion.A Species stands beyond -Invisible, as Music -But positive, as Sound -It beckons, and it baffles -Philosophy, dont know -And through a Riddle, at the last -Sagacity*, must go.*the quality of being perceptiveWhich statement best describes how capital letters add to the poems overall meaning?They emphasize ideas that cannot easily be understood.They highlight things the speaker would like to do.They suggest that the speaker often overthinks problems.They explain why the world will continue forever. What is the domain of 1 x? As a universal precaution, use _______ whenever possible if you are going to be in contact with bodily fluids. A. latex gloves B. band-aids C. lotion D. water