TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Answers

Answer 1

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  


Related Questions

scientists may make many genetically identical copies of an organism called _____

A. plasmids
B. hybrids
C. clones
D. mutants

Answers

Answer:

C. Clones

Explanation:

Clone definition: An organism or cell, or group of organisms or cells, produced asexually from one ancestor or stock, to which they are genetically identical.

Hope this helps! :3

Results from a wide-range of climate model simulations suggest that the Earth's average surface temperature could be between 1. 1 and 5. 4°C warmer in 2100 than it was in 2015. Which best summarizes this information:


By 2100, the global average annual temperature will increase more than 1. 1 and less than 5. 4°C.



By 2100, the global average annual temperature will decrease more than 1. 1°C.



By 2100, the global average annual temperature will increase more than 5. 4°C.



By 2100, the global average annual temperature will decrease more than 1. 1 and less than 5. 4°C

Answers

Results from various climate model simulations suggest that the Global average temperature in 2100 could be 1.1 to 5.4 °C (2 to 9.7 °F) higher than today. The main cause of this temperature rise is "greenhouse gases" that trap carbon dioxide and other heat produced by human activity.

Global average temperature is projected to increase by 2°F to 11.5°F by 2100, depending on future greenhouse gas emission levels and the results of various climate models.

Fossil fuels release carbon dioxide, a greenhouse gas that can increase the average temperature of the earth. In a high-emissions scenario, global temperatures could rise by 4.4 degrees by 2100, says the IPCC, with potentially catastrophic consequences.

For more information on Global average temperature , visit :

https://brainly.com/question/19695449

#SPJ4

Give three ways the human body would change if all cells in the human body were the same.

Answers

Well for one there wouldn’t be a body or at that organs at all. This is because it would be physically impossible for all cells to be the same as we wouldn’t be able to carry out vital bodily functions for everyday living.

This is due today, I’ll give brainliest to whoever answers with the best answer.
This is for 30 POINTS!!!!!!
DUE TODAY

Answers

Gravity holds the sun, earth, and moon together, and these three bodies engage in a variety of interactions. Due to the earth's gravitational attraction, the moon revolves the planet. And because of the sun's gravitational attraction, the earth orbits the star.

What angle is the Moon at with respect to the Sun and Earth?

The Moon travels in tandem with Earth's orbit around the Sun. Despite the Earth's continued motion, the Moon must travel two additional days during its orbit, which lasts 27 1/2 days.

How near to one another are the Earth, Moon, and Sun?

The Moon is 384,403 kilometres away from Earth on average. Additionally, there are 149,597,887 kilometres between the Earth and the Sun on average.

To know more about Sun and Earth visit:-

https://brainly.com/question/12528243

#SPJ1

What could have been a valid conclusion on the basis of Mendel's experiments ?

Answers

The differential inheritance of genes for two different traits may be a valid conclusion based on Mendel's experiments.

Mendel concluded that traits can be divided into overt and latent traits. He named these dominant and recessive traits respectively. Dominant traits are traits that are inherited unchanged by hybridization.

The key principles of Mendelian inheritance are summarized by Mendel's three laws: Law of Independent Collection, Law of Domination, Law of Separation.

Through his pea breeding experiments, Mendel developed his three principles of inheritance that account for the transmission of genetic traits before anyone knew of their existence. Mendel's discoveries greatly expanded our understanding of heredity and led to the development of new experimental methods.

For more information on Mendel's laws of inheritance , visit :

https://brainly.com/question/29785142

#SPJ4

When you don't consume enough protein, your body will start using your muscles and organs as a source of protein. T/F

Answers

It is true when you don't consume enough protein, your body will start using your muscles and organs as a source of protein.

A structure composed of amino acids. The body need proteins to function properly. They serve as the building blocks for several bodily components, including the skin, hair, and enzymes, cytokines, and antibodies.

A severe protein deficiency can hinder children's growth, contribute to fatty liver and skin, induce edema, and worsen infections. True deficiency is uncommon in affluent nations, although a low intake can lead to muscular atrophy and an increased risk of fractures.

Additionally, a lack of protein over time might cause you to lose muscle mass, which will reduce your strength, make it more difficult for you to maintain your balance, and slow down your metabolism.

To learn more about Protein :

https://brainly.com/question/884935

#SPJ4

Categorize all the components involved in photosynthesis as either matter or energy!

Answers

In photosynthesis, matter components are chlorophyll, water, carbon dioxide and glucose. Energy components are light energy, chemical energy, thermal energy.

Matter:

Chlorophyll: a pigment found in the chloroplasts that absorbs light energy

Water: a molecule that is oxidized during the light-dependent reactions

Carbon dioxide: a molecule that is used as a source of carbon for the synthesis of organic compounds

Glucose: a simple sugar produced as a result of the light-independent reactions.

Energy:

Light energy: energy from the sun that is absorbed by the chlorophyll to drive the reactions of photosynthesis

Chemical energy: energy stored in the bonds of glucose and other organic compounds produced during photosynthesis

Thermal energy: energy in the form of heat that is released as a byproduct of the reactions of photosynthesis.

To know more about  Chlorophyll  click below:

https://brainly.com/question/13500580#

#SPJ4

In two or more complete sentences, describe an activity you perform that has an impact on climate change? Is it positive or negative? Can it be adjusted to improve our climate? Justify your answers in two or more complete sentences. Write your answer in the essay box below.

Answers

Answer:

Burning of woods has a negative impact on the climate.

Explanation:

Burning of woods for heating has a negative impact on our climate because it releases carbondioxide gas which is a greenhouse gas that trapped the reflected solar radiation and leads to global warming. We have to used alternative methods for heating such as electric heater instead of burning of wood which produce no pollution and can fulfill the requirement of heating so from the above discussion we can say that the activity has a negative impact on the environment.

need help asap
question 9
- 20 points

Answers

I say it’s decreasing as the youngest 8 populations are smaller than their parental population ( the 8 above them)

Adam writes the following hypothesis, "Grasshoppers prefer plants with higher levels of
sugar content" His hypothesis was not supported by his data but he wants to find out if
other insects prefer plants with higher levels of sugar in them. Why is his original
hypothesis still valuable?

A. It can lead to further investigations

B. It is clearly written

C. It involves the study of insects

D. It was disproven

Answers

Answer:

b

Explanation:

i got a hundred on it

why does a frog have a dual mode of breathing? HOTS

Answers

the frog has dual mode of breathing because the frog requires it when it is staying on land it uses its lungs for breathing and when it stays in water it uses gills for breathing.

In toxicity testing, the dose of a chemical above which there is a measurable decline in the health of the organism being tested is referred to as

Answers

In toxicity testing, the dose of a chemical above which there is a measurable decline in the health of the organism being tested is referred to as the toxicity threshold.

A level of the dose above which the toxic effects of the dose can be observed in an organism is known as the toxicity threshold.

Below the threshold dose, no toxic effects are observed. Toxicity testing, also referred to as safety testing or toxicity analysis, is the study of the extent to which an interested substance adversely affects an organism’s normal functions, based on exposure time, exposure route, and concentration of the substance.

To learn more about the toxicity, refer to the link:

https://brainly.com/question/1563060

#SPJ1

what organelle is the colored green and located on the outside of the plant cell?

Answers

Answer: Chloroplast

Explanation:

An important regulator of electrolyte concentrations in extracellular fluids is .

Answers

Answer:

Mineralocorticoid

Explanation:

Answer:

Aldosterone

Explanation:

Hope this helps!

Please mark me as Brainlinieast.

What effect did the agricultural revolution have on the growth of the human population?

Answers

Answer: Positive and Negative

Explanation: As these early farmers became better at cultivating food, they may have produced surplus seeds and crops that required storage. This would have both spurred population growth because of more consistent food availability and required a more settled way of life with the need to store seeds and tend crops.

What happens to a plant cell during cellular respiration?
The cell rests
The cell absorbs water
O The cell releases oxygen
The cell releases stored energy

Answers

Answer:

releases energy

Explanation:

Answer:

The cell releases oxygen The cell releases stored energy

Explanation:

During cellular respiration, the mitochondria take in carbon dioxide and purify it back into oxygen. Huamns also have this process, but in a much smaller manner. This process is what gives us oxygen on our planet.

Biodiversity Assignment

Answers

Answer:

what is the assignment on

have a good day :)

Explanation:

Answer:

What's the main question of the assignment.

Which substance is NOT a known carcinogen?
a) latex
b) tobacco products
c) radiation
d) sunlight

Answers

D is the answer to your question!!

Carcinogens are the agents that cause cancer in an organism and can be man-made or natural. Latex is not a type of carcinogen. Thus, option a is correct.

What are carcinogens?

Carcinogens are the substances that can be a chemical or a biological compound that are capable of causing cancers. They can be natural agents like UV rays from sun, solar radiations, or viruses or can be a man-made substance like tobacco, nicotine, fumes.

These substances are capable of causing genetic mutations by altering the genomic sequence and the nitrogenous base that affects the genotype and the phenotype. The carcinogens leads to growth of abnormal and cancerous cells. Latex is a secondary metabolite that doe not causes cancer.

Therefore, option a. latex is not a carcinogenic agent.

Learn more about carcinogens here:

https://brainly.com/question/14051174

#SPJ2

Why do you think a composer would want to alter or highlight a rhythm or a tone?

Answers

Answer: A composer may want to alter or highlight a rhythm or a tone to create a desired effect or mood. By emphasizing certain rhythms or tones, a composer can create a sense of urgency, tension, or excitement. Additionally, by altering the rhythm or tone, a composer can add texture or depth to a piece of music, making it more interesting and unique.

Both ferns and cender trees rely on .............. To successfully fertilize themselves

Answers

Answer:

Explanation:

Both ferns and cedar trees rely on wind-dispersed pollen to successfully fertilize themselves.

Ferns are a group of vascular plants that reproduce via spores. These spores are produced in clusters called sori, which are found on the underside of fern fronds. The spores are released from the sori, and are carried away by the wind to fertilize other ferns.

Cedar trees, which are coniferous trees, also rely on wind to disperse their pollen. The male and female cones of the tree are separate, with the male cones releasing pollen into the air which is carried by the wind to fertilize the female cones on the same or nearby trees.

Both ferns and cedar tree do not produce flowers or rely on animal vectors (like bees or butterflies) for pollen transport, they use the wind to move their reproductive cells and complete the fertilization process.

Which is an example of a recent development used to address food shortages in urban areas?

Answers

Answer:

A is answer

Explanation:

A recent development to address food shortages in urban areas is to create community gardens. The city usually sets aside a space for people to grow their own food.

Answer:

Its b.

Explanation:

If LaL turns into a gel when exposed to a sample, it means the sample is contaminated with gram-negative bacteria

Answers

It is true that If LaL turns into a gel when exposed to a sample, it means the sample is contaminated with gram-negative bacteria.

Both the color and the turbidity of LAL are used to identify endotoxins. The mixture turns yellow when the kinetic chromogenic LAL reagent reacts with endotoxins. By looking for pyrogenic responses in horseshoe crab blood cells, this identifies the presence of bacterial endotoxins. The outer membrane of Gram-negative bacteria contains endotoxins. In order to ensure product safety and quality in the medical and pharmaceutical industries, their detection is essential. Gram-negative bacteria's outer membrane and cell wall are primarily made up of endotoxins.

Know more about Gram-negative bacteria here: https://brainly.com/question/13756030

#SPJ4

(complete question)

If LaL turns into a gel when exposed to a sample, it means the sample is contaminated with gram-negative bacteria.

true or false.

The circle graph below shows the percentage of water which are used for various activities in the United States which statement about the use of water in the untied states is false

Answers

Answer:

The answer is A. industrial use of water is greater than the amount used to cool power plants.

Explanation:

it just is

I need help plz!!!!!!!!why are the structures of plants ideal for photosynthesis? ​

Answers

Answer:

grrr science I aint helping LOL! im kidding HERE hope this helllpppsssss! (:

Explanation:

Plants have two major structural systems: the root system and the shoot system. ... The shoot system transports water and nutrients to leaves and flowers. The leaves of the plant are the main location for photosynthesis. Plant reproduction occurs through pollination of the flower and fertilization.

Plants have a root system, a stem or trunk, branches, leaves, and reproductive structures (sometimes flowers, sometimes cones or spores, and so on). Most plants are vascular, which means they have a system of tubules inside them that carry nutrients around the plant.

Unlike animals, however, plants use energy from sunlight to form sugars during photosynthesis. In addition, plant cells have cell walls, plastids, and a large central vacuole: structures that are not found in animal cells. Each of these cellular structures plays a specific role in plant structure and function.

how do mutations relate to natural selection

Answers

they relate because they both have to do with the behavioral patterns of the cycle of life. essentially they both are related to way things transform into one another
As mutations occur natural selection decides which mutations will live on and which ones will die out

The healthcare provider prescribes 375 mg of intravenous (iv) ampicillin iv every 6 hours for a 5-month-old with a recurrent respiratory infection. The drug is supplied as 500 mg of powder in a vial. The directions state that the powder should be mixed with 1. 8 ml of diluent, which yields 250 mg/ml. How many milliliters should the nurse administer? take your answer to one decimal place. ___ ml

Answers

The nurse should administer 1.5 mg of ampicillin IV to the  5-month-old patient with a recurrent respiratory infection.

Respiratory infection is the infection of the respiratory system, especially of the respiratory pathways like the nose, throat, bronchi, etc. They usually are mild in nature which can be relieved on their own, However some diseases can cause severe effects. The examples are cold, common flu, COVID-19, etc.

The amount of ampicillin can be calculated by using the Desired over Have formula, that can be expressed as:
Dose ordered / Dose Have = Amount needed to be given.
Therefore 375 / 250 = 1.5 mg

To know more about respiratory infection, here

brainly.com/question/28289710

#SPJ4

Select the best answer for the question
20. A specific aphid is known to infest spinach, peppers, and tomatoes. How could a farmer use biological control to reduce aphids on these crops?
O A. Apply neem oil to the crops
O B. Introduce ladybugs to eat the aphids
O C. Introduce honeybees to pollinate the crops
D. Only plant crops that produce the Bt toxin

Answers

Answer:

O B. Introduce ladybugs to eat the aphids

Explanation:

In crop production, there are certain pests known to categorically affect a particular crop plant. Hence, there are ways devised to tackle this issue of pest attack on crops. One of those ways is the "BIOLOGICAL CONTROL METHOD".

The biological control method involves the use of natural enemies to combat pest organisms. The natural enemies are living organisms that prey on the so called pest organism. This is the case in this question, where a specific aphid is known to infest spinach, peppers, and tomatoes.

The farmer will employ biological control method in stopping these aphids by introducing ladybugs to eat the aphids.

Why does a single X chromosome that carriers the allele for red-green colorblindness cause males to be color blind but doesn’t cause females to be color blind

Answers

Because male sex chromosome is XY which has only one X. It will become dominant in male and cause colour blindness while female sex chromosome is XX in which if she has one allele that carries the colorblindess gene, it will only become carrier. Please remember that this alelle like hemophilic, thalassemia and colorblindess only stick with X alelle, never in Y. Hope it helps!

I WILL MARK BRAINLIEST + 5 STARS + A LIKE ANSWER THE QUESTION IN THE PHOTO

Answers

Answer:

1. Ribose (type of sugar found in ATP and ADP molecules)

2. The 3 phosphate groups (Energy is stored in the 3 phosphate groups and in order to bring the stored energy to use, the last phosphate bond breaks and energy is released)

3. ATP has a higher energy potential than ADP (This is cuz, ATP has 3 phosphate groups and ADP has 2 phosphate groups)

Hope this helps!

Which two of the following organisms are tertiary consumers in this food web?

Answers

Answer:

Snowy owl and Rough-legged hawk

Explanation:

Hard to tell but I believe I'm correct

Other Questions
How do we manage change in the workplace effectively? 2. Start by creating a list of 5-10 local and remote businesses currently operating that you think would hire projectmanagers? 40 POINTS dont explain. A competitive strategy to be the low-cost provider in an industry works well whenA. price competition among rival sellers is especially vigorous. B. there are few ways to achieve product differentiation that have value to buyers. C. buyers incur low costs in switching their purchases from one seller/brand to another. D. industry newcomers use low introductory prices to attract buyers and build a customer base. E. All of these. Find the numbers. A room is 12 feet longer than it is wide. Half the perimeter of the rectangular floor is 72 feet. Find the length and the width. Use elimination or substitution to solve this problem. Electrons have a______charge. How did the ancient Chinese preserve a person's body? what were pol pots ideals Aubrae Company is making adjusting entries for the year ended December 31 of the current year. In developing information for the adjusting entries, the accountant learned the following:a. A two-year insurance premium of $4,560 was paid on October 1 of the current year for coverage beginning on that date. The bookkeeper debited the full amount to Prepaid Insurance on October 1. b. At December 31 of the current year, the following data relating to Shipping Supplies were obtained from the records and supporting documents.Shipping on hand, January I of the current year $13,000Purchases of shipping supplies during the current year 75,000Shipping hand, counted on December 31 of the current year 20,000Required:a. Using the process illustrated in the chapter, record the adjusting entry for insurance at December 31 of the current year.b. Using the process illustrated in the chapter, record the adjusting entry for supplies at December 31 of the current year, assuming that the shipping supplies purchased during the current year were debited in full to the account Shipping Supplies.c. What amount should be reported on the current years income statement for Insurance Expense? For Shipping Supplies Expense?d. What amount should be reported on the current years balance sheet for Prepaid Insurance? For Shipping Supplies? if the area of a sector is 15pi square cm and the radius is 5cm find the measure of the central angle Why is it important to prioritize expenses? Attracting outside investment is easier for corporations than for sole proprietorships and partnerships because: The letters in the word ALGEBRA are placed in a bowl. What is the probability of NOT choosing A Jestem Polakiem wypracowanie If cost of 15 eggs is ? 75, then find out the cost of 4 dozens eggs. What are the external and internal factors which causes the changes in the earth's surface.List and explain Write an expression for the distance vector, d, in rectangular form in terms of d and , in a coordinate system with the dish at the origin and the unit vectors i and j in the horizontal and vertical directions. (to the right and up) What are Romanesque churches known for? you will break even when the cost of your supplies your income. How many cups of hot chocolate must you sell to break even' Which pair represents opposite numbers? Steam Workshop Downloader