What is atomic radius?​

Answers

Answer 1
The chemical element's atomic radius is measured by the size of its atoms, usually the medium or typical distance between the central nucleus and the surrounding electron shells. As the limit is not a well defined physical entity, different definitions of non-equivalent atomic radius exist.

Hope this helps!
Answer 2

Answer:

The atomic radius of a chemical element is the measure of the size of its atoms, usually the mean or typical distance from the centre of the nucleus to the boundary of surrounding shells of electrons

Hope it helps :)


Related Questions

The diagram at right shows a manometer connected to a flask. The mercury levels are measured in mm. the pressure in the room is 740mmHg. Determine the pressure of the gas in the flask.



on the flask it has 505mm and 465mm

Answers

pressure=585...

this is your answer

A solution is prepared by dissolving 51 g of salt in 340 g of
water. What is the mass percent of salt?

Answers

Answer:

okķkkkkkkkkkkkkkkkkkkkkk.I don't know the answer. GIVE THANKS

Standard temperature and
pressure (STP) is 273 Kand
[?] atm.

Answers

Answer:

Explanation:

273K

1ATM

Answer:

273 K 1 atm

Explanation:

Standard temperature and pressure (STP) is [273] K and [1] atm


Under the right conditions aluminum will react with chlorine to produce aluminium chloride.
2 Al +3 Cl2 - 2 AlCl3
How many grams of aluminum chloride can be produced when 157.0g of aluminum react with excess chlorine?
CORRECT ANSWER IS 775.9 g AICI3 but what are the steps to get that answer ?

Answers

Answer:

Ok

The Limiting reagent is Aluminum. Its not in excess. So the reaction ends once its exhausted. So all Aluminum will be used up

From the question ....

157g of Al

Find the number if reacting Moles...

M=mass/molar mass

M= 157/27

=5.81moles of Aluminum is reacting.

Now looking at the equation of reaction(Always make sure its balanced)...

2moles of Al react to produce 2 Moles of AlCl3

Their Mole ratio is equal

Since their Mole ratio is equal 2:2.... That means... That 5.81moles of AlCl3 would be produced because the mole of Al is 5.81

So We now know the Moles of AlCL3 produced

getting the Mass won't be difficult.

Again

Mole=Mass/Mm

Mass = Mole x Mm(Molar Mass)

Mass of AlCl3 = 5.81 x (27 + 35.5x3)

Note: The arithmetic done in the parenthesis is the molar mass of AlCl3

Mass of AlCl3 = 5.81 x 133.5

=775.63g of AlCl3.

Have a great Day!!!!

[H3O+] = 3.6 x 10-2 M

Answers

Answer:

Explanation:

Hello there!

In this case, since this concentration of hydronium ions is given, we infer we may calculate that of the hydroxide ions, pH and pOH because no question was specifically given. That is why we proceed as follows:

-  pH: Here, we use this concentration to calculate the pH according to the negative logarithm:

[tex]pH=-log(3.6x10^{-2})=1.44[/tex]

Which means that the solution is acidic as the pH is less than 7.

- pOH: since the pH added to the pOH is 14, we can calculate the latter as follows:

[tex]pOH=14-1.44=12.56[/tex]

- Hydroxide concentration: Given the pOH, we apply the antilogarithm to calculate such concentration as shown below:

[tex][OH^-]=10^{-pOH}=10^{12.56}=2.75x10^{-13}M[/tex]

Keep in mind, this is an arbitrary solution because no question was provided.

Regards!

help me i need it asap


Which example is a biotic factor of an aquarium ecosystem?

plastic plants placed in the gravel

algae growing on the glass

rock structure

gravel on the bottom of the aquarium


Which examples are an abiotic factor of an aquarium ecosystem? Select all that apply.

rock structure

temperature of the water

amount of algae on the glass

number of fish


Which example describes an abiotic factor interacting with a biotic factor?

The temperature of the air affecting the wind direction

Water eroding a rock

Cows eating nearby grass

The amount of sunlight affecting the growth of a plant.


Students in Ms. Brown's class are making observations in the garden outside of the school. They make a list of all the abiotic and biotic factors in their notebook. Part of the list is below:

Gravel
Grass
Butterfly
Sunflower
Bird feeder
Flowerpots

Which items on the list are a part of the garden ecosystem?

Grass, butterfly, sunflower

None of the listed items are a part of the ecosystem

All the listed items are part of the ecosystem

Gravel, bird feeder, flowerpots

Answers

The biotic factor of an aquarium ecosystem is algae growing on the glass.

The abiotic factors of an aquarium ecosystem are rock structure, temperature of the water, and amount of sunlight.

The example that describes an abiotic factor interacting with a biotic factor is the amount of sunlight affecting the growth of a plant.

All the listed items in Ms. Brown's class, including gravel, grass, butterfly, sunflower, bird feeder, and flowerpots, are a part of the garden ecosystem.

What is an ecosystem?

An ecosystem is a community of living organisms (biotic factors) interacting with each other and with their physical environment (abiotic factors) in a specific area. It includes all the living and non-living components of the environment that interact with each other. Examples of ecosystems include a coral reef, a forest, a desert, and even an aquarium or a garden. Ecosystems can be large or small and can be found on land or in water. They are essential for the survival of living organisms as they provide food, shelter, and other resources necessary for life.

Read more on ecosystem here:https://brainly.com/question/842527

#SPJ1

8. Jill conducted an experiment to investigate which plant food would make her
plants grow faster. She tried four different plant foods on plants of the same
type and age. Jill concluded that the plant that was fed Brand A grew the
fastest. Jill did not realize that the plant that was fed Brand A also received
more sunlight. (SC.7.N.1.5.3)
What error did Jill make in her experiment?
a) She used the wrong kind of plant.
b) She used too much plant food.
c) She did not control the variables.

Answers

the answer is cccccc
c) She did not control the variables.

In her experiment, Jill did not take into account the fact that the plant that was fed Brand A also received more sunlight. This means that there is another variable, besides the plant food, that could have affected the growth rate of the plant. By not controlling this variable, Jill's conclusion that Brand A was the best plant food may not be accurate. To properly control variables and make a valid conclusion, Jill should have ensured that all plants received the same amount of sunlight, or use other methods to control this variable as well.

Need help on this one

Answers

Answer:

Explanation:convection

The correct answer is D. conduction

Scientists found the remains of dinosaur fossils in a remote section in the west, located
within ten miles of a meteor crash site. Which statement can be made about the
dinosaur and the meteor?
O a. The dinosaur could have died from a flood.
O b. The dinosaur and the meteor are not related.
O c. The dinosaur could have died from freezing to death.
O d. The dinosaur could have died due to an meteor crash.

Answers

Answer:

D  The dinosaur could have died due to an meteor crash.

Explanation:

Answer:

D

Explanation:

The dinosaurs fossils were found ten miles away from the meteor crash site. Correct me if I'm wrong

3. Which body system protects the inside of our body and regulates our body temperature? ​

Answers

Answer:

integumentary system

Explanation:

The integumentary system reduces water loss, contains receptors that respond to touch, regulates body temperature, and protects the inside of the body from damage. Receptors in skin send sensory information to the brain.

Answer:

Integumentary system

Explanation:

The integumentary system is the largest organ of the body, equaling 15-20% of our total body mass. It acts as a barrier to physical, chemical, and biological agents. The skin prevents water loss and regulates body temperature

A classroom has one triple-beam balance. To complete an experiment, each student must use the balance for 6 minutes. The class meets for 1 hour. How many students can participate in the experiment?

Answers

As the class is of 1 hour and  and each student uses for 6 minutes so in 1 hour 10 students will use the balance.

What is a balance?

A scale or balance is a device used to measure weight or mass. These are also known as mass scales, weight scales, mass balances, and weight balances.

The traditional scale consists of two plates or bowls suspended at equal distances from a fulcrum. One plate holds an object of unknown mass (or weight), while known masses are added to the other plate until static equilibrium is achieved and the plates level off, which happens when the masses on the two plates are equal.

Learn more about balance,here:

https://brainly.com/question/1173599

#SPJ1

You have used 310 L of distilled water for a dialysis patient. How many gallons of water is that?

Answers

Answer:

82 gallons

Explanation:

There are 3.785 liters in one gallon. In order to get the amount of gallons, divide the amount of liters by 3.785.

310 L ÷ 3.785 L/gal = 81.89 gallons ≈ 82 gallons

Put the levels of ecosystems in order from smallest to largest:

ecosystem, community, individual, population

Reorder answers
1.population

2.ecosystem

3.individual

4.community

Answers

Population, community, ecosystem, individual

Thomas collected the data in Table 1 to answer a statistical question. Which statistical question does the data in Table 1 answer?

Answers

Answer:

how tall each sibling is

Explanation:

bc it says height

Researchers are attempting to create a new battery based on the following chemistry and would like the battery to produce 1.0-1.2 volts. Given the standard cell potential of the reaction, they propose to connect 3 identical cells inside the single new battery. Calculate the voltage of this (3-cell) battery at 25 C when 1.3 M Fe and 0.010 M Fe in pH 3.1 buffer react with O at 0.20 atm. (For full credit your answer must be correct to /-0.02.)

Answers

Answer:

Hello your question has some missing data attached below is the missing data ( Note: the PH in the attached question is 3.2 but the PH value I used in the solution = 3.1 as requested in the initial question )

answer : 0.41 volts

Explanation:

Given data :

[ Fe²⁺ ] = 1.3 M

[ Fe³⁺ ] = 0.010 M

[ H⁺ ] = 10^3.1

O2 = 0.20 atm

E⁰cell = 0.46 volts

temperature = 25°C ( room temperature )

Calculate the voltage of this ( 3 -cell battery )

we can apply the relation below

E = E⁰cell - ( 0.0591 / n )*Log Q

  = 0.46 - ( 0.0591 / 4 )*Log [ (0.01)^4 / (1.3)^4 * (10^3.1)^4 * 0.2 ]

  = 0.4120 Volts

Note : Q is determined from the equation attached to the question

What does a group of atoms joined by chemical bonds create?
•A molecule
O A compound
O A fission reaction
O A fusion reaction

Answers

Answer:

I can say that it is not a compound because I got it wrong

Explanation:

Answer:

Molecule

Explanation:

I took the test

State Faraday's 2nd law of electrolysis​

Answers

Answer:

[tex]{\huge\red{\fbox{{Faraday's 2nd Law of Electrolysis :-}}}}[/tex]

According to the second law of electrolysis, the same quantity of electricity will produce or dissolve chemically equivalent amounts of all the substances. This quantity of electricity is called Faraday (F). One Faraday is equal to 96487 coulombs per mole of electronic charges.

Which statement best describes general equilibrium? Equilibrium is reached when the reaction stops. There is only one set of equilibrium concentrations that equals the Kc value. At equilibrium, the rate of the forward reaction is the same as the rate of the reverse reaction. At equilibrium, the total concentration of products equals the total concentration of reactants.

Answers

Answer:  The statement 'At equilibrium, the rate of the forward reaction is the same as the rate of the reverse reaction' best describes general equilibrium.

Explanation:

A chemical process in which the rate of forward reaction is equal to the rate of backward reaction.

For example, [tex]A + B \rightleftharpoons C + D[/tex]

This reaction is an equilibrium process. Symbol which represents the equilibrium is '[tex]\rightleftharpoons[/tex]'.

Thus, we can conclude that the statement 'At equilibrium, the rate of the forward reaction is the same as the rate of the reverse reaction' best describes general equilibrium.

What is bungee gum made of? A) The properties of both rubber and gum. B) Bungee cord and gum.

Answers

The anime character?

Answer:

The proporties of both rubber and gum.

Explanation:

50mL of potassium hydroxide (KOH) solution contains 7 grams of potassium hydroxide.
What is the molarity (mol/L) of the potassium hydroxide solution?
Given the atomic masses:
K= 39,0 = 16 and H= 1​

Answers

Answer:

2.5 mol/L

Explanation:

We'll begin by calculating the number of mole in 7 g of KOH. This can be obtained as follow:

Mass of KOH = 7 g

Molar mass of KOH = 39 + 16 + 1

= 56 g/mol

Mole of KOH =?

Mole = mass /molar mass

Mole of KOH = 7 / 56

Mole of KOH = 0.125 mole

Next, we shall convert 50 mL to L. This can be obtained as follow:

1000 mL = 1 L

Therefore,

50 mL = 50 mL × 1 L / 1000 mL

50 mL = 0.05 L

Finally, we shall determine the molarity of the KOH solution. This can be obtained as follow:

Mole of KOH = 0.125 mole

Volume = 0.05 L

Molarity of KOH =?

Molarity = mole / Volume

Molarity of KOH = 0.125 / 0.05

Molarity of KOH = 2.5 mol/L

Thus, the molarity of the KOH solution is 2.5 mol/L

What information does an equilibrium constant give about a reaction?
O A. It tells how long it takes the reaction to reach equilibrium.
B. It tells whether products or reactants are favored at equilibrium.
C. It tells how much energy is required for the reaction to happen.
O D. It tells what the rate constant of the reaction is at equilibrium.

Answers

Answer:

B. It tells whether products or reactants are favored at equilibrium.

how many moles of hydrogen fluoride to make 16 moles of hydrogen

Answers

Answer: You can view more details on each measurement unit:

Explanation:

molecular weight of Hydrogen Fluoride or mol The molecular formula for Hydrogen Fluoride is HF. The SI base unit for amount of substance is the mole. 1 grams Hydrogen Fluoride is equal to 0.049984147027929 mole.

What is the number of moles in 0.025 g (NH4)2Cr2O7?
A) 1.5 x 1022
B) 4.2 x 10-26
C) 6.3
D) 1.0 x 10-4
E) 1.0 x 104

Answers

Answer: D

Explanation:

d

The number of moles in 0.025 g of  (NH[tex]_4[/tex])[tex]_2[/tex]Cr[tex]_2[/tex]O[tex]_7[/tex] is 1.0 x 10⁻⁴moles. The word "mole" is shortened to "mol".

What is mole?

A mole is just a measuring scale. In reality, it's one of the International System for Units' seven foundation units (SI). When already-existing units are insufficient, new ones are created. The mole is indeed a SI unit that is used to quantify any quantity of a material. The word "mole" is shortened to "mol". Exact number of particles in one mole is 6.0221407610 23.

The levels at which chemical reactions frequently occur exclude the use of grams, yet utilizing actual numbers of atoms, molecules, or ions would also be unclear. To fill this gap between extremely small and extremely huge numbers, scientists created the mole.

number of mole of (NH[tex]_4[/tex])[tex]_2[/tex]Cr[tex]_2[/tex]O[tex]_7[/tex] = given mass / molar mass

                                                    =  0.025 / 252.07

                                                   =9.91 × 10⁻⁵moles

                                                   =  1.0 x 10⁻⁴moles

Therefore, the correct option is option D

To learn more about mole, here:

https://brainly.com/question/15209553

#SPJ2

A certain compound consists of 54.53% C, 9.15% H, and 36.32% O by mass. The molar mass of the compound is 88.10g/mol, What is the molecular formula of this compound?

Answers

The compound is going to have the molecular formula; [tex]C_{4} H_{8}O_{2}[/tex]

What is the molecular formula?

We know that the molecular formula is the formula of the compound that shows the number of the atoms of each of the elements that we can be able to find in the compound.

Now for the compound that we have, we divide through by the relative atomic mass of each;

C - 54.53/12    H -  9.15/1   O - 36.32/16

C - 4.5        H - 9.15    O - 2.27

Dividing through by the lowest ratio;

C - 4.5/2.27   H - 9.15/2.27     O - 2.27/2.27

C - 2   H - 4    O -1

The empirical formula is [tex]C_{2} H_{4} O[/tex]

We now have;

[2(12) + 4(1) + 16] n= 88.1

n = 88.1/44

n = 2

The molecular formula is;

[tex]C_{4} H_{8}O_{2}[/tex]

Learn more about molecular formula;https://brainly.com/question/28647690

#SPJ1

I need help with how to do question c, d, and e

Answers

The answer of the following question of concentration are:

c) The law expression for this reaction is k[A].

d) The value of k including its units is  on the specific reaction.

e) The half-life of the reaction is T1/2 = 0.693/k.

What is concentration?
Concentration
in chemistry is a measure of the amount of a substance that is present in a given volume. It is usually expressed in terms of mass, moles, or volume.

c) The law expression for this reaction is rate = k[A], where k is the rate constant. This is because in a first-order reaction, the rate of reaction is proportional to the concentration of the reactant.

d) The value of k depends on the specific reaction, and can be determined by measuring the reaction rate at different concentrations of A and plotting a graph of rate versus concentration of A.

e) The half-life of a first-order reaction is given by T1/2 = 0.693/k, where T1/2 is the half-life and k is the rate constant. The units of the half-life are seconds.

To learn more about concentration
https://brainly.com/question/26255204

#SPJ1

Q13 Which compound has a boiling point that is influenced by hydrogen bonding?
A CH3CHO
B CH3OCH3
C HCO2H
D HCO2CH3​

Answers

Answer:

[tex]A. \: \: CH _{3}CHO[/tex]

ethanal

This is because hydrogen is bonded with oxygen atom which is highly electronegative.

an object can be considered in motion when it changes only it's direction. true or false?​

Answers

Answer:

Its false Because it does'snt only show directions and changes there are others too.

Explanation:

hope it helps!!

Answer:

false

Explanation:

it's false because it's in motion

what amount of oxygen gas in moles contains 1.8x10^22 molecules?​

Answers

Answer:

0.03 moles

Explanation:

To find the number of moles in a substance given it's number of entities we use the formula

[tex]n = \frac{N}{L} \\[/tex]

where n is the number of moles

N is the number of entities

L is the Avogadro's constant which is

6.02 × 10²³ entities

We have

[tex]n = \frac{1.8 \times {10}^{22} }{6.02 \times {10}^{23} } \\ = 0.02990...[/tex]

We have the final answer as

0.03 moles

Hope this helps you


No FILES PLZZ
What can all non-renewable resources theoretically be?
A
converted to nonmetallic minerals
B
converted to renewable ones
exhausted or depleted
D
recycled or reused

Answers

Answer:

B.

Converted to renewable ones

exhausted or depleted

B converted to renewable ones

Constant Volume
A 10.0L sample of gas in a rigid container at 1.00 atom and 200K is heated to
800K. Assuming that volume remains constant, what is the new pressure of the gas?
After
Can someone help me please

Answers

According to the question the new pressure of the gas is: 6.5512 kPa

What is pressure?

Pressure is the force applied to a surface divided by the area of the surface on which the force is applied. It is measured in units of force per unit area, such as pounds per square inch (psi) or pascals (Pa). Pressure can be caused by a variety of factors, such as the weight of air, the weight of a liquid, or the force of a gas. Pressure is an important concept in many fields, including physics, engineering, and chemistry.

The ideal gas law can be used to determine the gas's new pressure:

PV = nRT

where R is the universal gas constant, n is the number of moles, P is the pressure, V is the volume, and T is the temperature.

We know that V = 10.0L, n = 1.00 mole, R = 8.314 J/molK, and T = 800K.

As a result, the gas's new pressure is:

P = (1.00 mol * 8.314 J/molK * 800K) / 10.0L = 6.5512 kPa

To learn more about pressure

https://brainly.com/question/25736513

#SPJ1

Other Questions
i need help im almost done and this is my second to last question probably helpppp please help !!!!!!!! conjugate these three words in the future tense: I will be awarding brainliest for anybody who gets it right, 3 new titles for Insurgent and a paragraph describing why The wind force f on a sail varies jointly as the area a of the sail and the square of the wind speed w. The force on a sail with an area of 500 ft^2 is 64. 8 pounds when the wind speed is 18 mph. What would be the force for a sail with an area of 250 ft^2 with a wind speed of 35 mph Are Tropical rain forests are typically located close to the equator? plane flew from Red Deer to Winnipeg, a flying distance of 1260 km. On the return journey, due to a strong head wind, the plane travelled 1200 km in the same time it took to complete the outward journey. On the outward journey, the plane was able to maintain an average speed 20 km/hr greater than on the return journey. Calculate the average speed of the plane from Winnipeg to Red Deer. To pay for a $15,900 car, Donna made a down payment of $4800 and took out a loan for the rest. On the loan, she paid monthly payments of $245.70 for 4years.(a) What was the total amount Donna ended up paying for the car (includingthe down payment and monthly payments)?(b) How much interest did Donna pay on the loan? Is this correct? I can't figure out if this is, So please answer. streamlined transportation vehicle with 2 openings and glass windows. It appears to run on some kind of track.Predict what the text will be about based on this image?a.future transportationc.both of theseb.public transportationd.neither of these Sam has always been able to pick up new languages easily. What quality does she have that helps her do this?soft skills.self-awarenesscompetencyability What baseball stat does Lawrence Hinman suggest is the most important stat for determining the best player in the game in a given year Where should the comma go in the following sentence **You should not need to round on this problem, no %'s decimals only**At Houston Community College 60% of the students who take English will pass. Of those who pass English, 70% will also pass Accounting. Of those that do not pass English, 45% will still pass accounting. How do you find the 3rd side of a triangle? Select the correct answer. Which graph represents the solutions to this equation? x2 + 8x = -20 A. Linear-quadratic system graph shows upward parabola with vertex at (minus 2, 4) and passing through x and y-axis (minus 8, 0), and (0, 0) B. Linear-quadratic system graph shows upward parabola with vertex at (minus 4, 4) and passing through (minus 2, 8), and (minus 6, 8) C. Linear-quadratic system graph shows upward parabola with vertex at (4, 0) and passing through (1, 4), and (6, 4) D. Linear-quadratic system graph shows a downward parabola with vertex at (0, 8) which intercepts the x-axis at 3 and minus 3 units. Lila swam 50 meters north in 10 seconds. Find Lila's velocity TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets. True/False: Money is more important than finding something you're going to lovedoing. Select the correct answer.Which of these is an example of elemental carbon?A. DiamondB. MethaneC. Proteins 6 less than 3 times a number 42 what is the number