A pizza has an 18 inch diameter and is sliced into 12 pieces. What is the length of the crust on the edge of one piece of pizza?
answers:
3 pi
4.5 pi
6 pi
1.5 pi

Answers

Answer 1

The required length of the curst on the edge of one piece of pizza 1.5 π. Option D is correct.

What is the perimeter?

Perimeter is the measure of the figure on its circumference. The perimeter of a circle is given as 2πr, where r is the radius of the circle.

here,
A pizza has an 18-inch diameter
Circumference of pizza = 18π

The pizza is sliced into 12 pieces, and the length of the crust on the edge of one piece of pizza is given as,
= 18π/12
= 1.5π

Thus, the required length of the curst on the edge of one piece of pizza is 1.5 π.

Learn more about perimeter here:

brainly.com/question/6465134

#SPJ1


Related Questions

Im sick and tired of people not answerimg my question or trolling me. PLEASE ANSWER ive been stuck on this for 15 minutes

Answers

Answer:

no, because she needs 480 grams and the bottle only contains 350

Step-by-step explanation:

i'm sorry you had to wait , i hate trolls as well :(

How do you find the third angle of a triangle if two angles are given?

Answers

To find the third angle of a triangle if you know the measures of the other two angles, you can use the fact that the sum of the measures of the angles in any triangle is always 180 degrees.

For example, let's say you know that angle A measures x degrees and angle B measures y degrees. To find the measure of angle C (the third angle), you can use the following equation:

x + y + C = 180°

To solve for C, you can subtract x and y from both sides of the equation:

C = 180 - x - y

So, the measure of angle C is equal to 180 degrees minus the measure of angle A and angle B.

To know more on Angle sum property of a triangle

https://brainly.com/question/8492819

#SPJ4

Which of the following is a radical equation?
X+ sr 5-12 X^2 = 16
3+ x sr 7 = 13
7sr x =14

Answers

it is A because it can’t be B and it can’t be C and it can’t be D so my answer is A

I will mark 1st correct answer as brainliest
Let f(x) = log base 3 of x and g(x) = 3^x.
What is the value of

[f(g(f(f(f(g(27))))))?]

I will mark 1st correct answer as brainliest

Answers

The value of the composite function [f(g(f(f(f(g(27))))))], when f(x) = log₃(x) and g(x) = 3ˣ is 1

How to evaluate the composite function

From the question, we have the following parameters that can be used in our computation:

Let f(x) = log base 3 of x and g(x) = 3^x.

Express the equations properly

So, we have the following representations

f(x) = log₃(x) and g(x) = 3ˣ

Calculating the composite function [f(g(f(f(f(g(27))))))], we have

[f(g(f(f(f(g(27))))))] = [f(g(f(f(f(3²⁷))))))]

Next, we have:

[f(g(f(f(f(g(27))))))] = [f(g(f(f(log₃(3²⁷))))))]

This gives

[f(g(f(f(f(g(27))))))] = [f(g(f(f(27))))))]

For f(27), we have

[f(g(f(f(f(g(27))))))] = [f(g(f(3)))))]

For f(3), we have

[f(g(f(f(f(g(27))))))] = [f(g(1))))]

Calculating g(1), we have

[f(g(f(f(f(g(27))))))] = f(3)

Lastly, we have

[f(g(f(f(f(g(27))))))] = log₃(3)

Evaluate

[f(g(f(f(f(g(27))))))] = 1

Hence, the solution is 1

Read more about composite function at

https://brainly.com/question/26044179

#SPJ1

In Mrs. Trainer's math class, Siobhan's first five math quiz scores are 76, 96, 81, 69, and 41. Siobhan takes the sixth math quiz and scores an 85. How will the mean change if the sixth score is added to the list?

Answers

Answer:

  the median will go up 2.5 points from 76 to 78.5

Step-by-step explanation:

You want to know the effect on the median of adding 85 to the list of scores: 76, 96, 81, 69, 41.

Median

The median is the middle value when the list is sorted into order. The ordered list is ...

  41, 69, 76, 81, 96

The median is 76.

New Median

When 85 is added to the list, the sorted list becomes ...

  41, 69, 76, 81, 85, 96

There are two middle scores, so the median is their average:

  (76+81)/2 = 78.5

The median increases 2.5 points from 76 to 78.5 when the score is added.

Use the distributive property to rewrite each expression. Then evaluate. 14 (102)

Answers

Using the distributive property to rewrite the expression, gives (14 x 10) + ( 14 x 2). When evaluated, the result would be 168.

What is the distributive property?

According to the distributive property, it is necessary to multiply each of the two numbers by the factor before performing the addition operation when a factor is multiplied by the sum or addition of two terms.

This means that with the formula given, 14 (10 + 2):, the distributive property makes it:

= 14 (10 + 2)

= (14 x 10) + ( 14 x 2)

The evaluation gives :

= (14 x 10) + ( 14 x 2)

= 140 + 28

= 168

In conclusion, using the distributive property gives (14 x 10) + ( 14 x 2).

Find out more on the distributive property at: https://brainly.com/question/2807928

#SPJ1

PLEASE HELP f(x)=x^2-12x+35 g(x)=x−5, find(f⋅g)(x)

Answers

Step-by-step explanation:

this is a multiplication dot, right ?

so,

(f.g)(x)

or

(f×g)(x)

any arithmetic operation (like +, -, ×, ÷) between 2 functions is done by applying that operation to the functional expressions.

(f×g)(x) = (x² - 12x + 35)(x - 5) =

= x³ - 5x² - 12x² + 60x + 35x -175 =

= x³ - 17x² + 95x - 175

Step-by-step explanation:

(f.g)(x) = f(x) . g(x)

= (x² - 12x + 35)(x - 5)

=x(x²-12x+35) - 5(x²-12x+35)

= x³-12x²+35x-5x²+60x-175

(f.g)(x)=x³-17x²+95x-175

1. You find that of your simplified responses to A through E match to a simplified response among F through J. List the matches by letter and write what the simplified response is to each matched pair.
Answer:
2. Determine the modulus of each of the complex numbers in the matching pairs. List these moduli in order from smallest to largest. Use the letters of the matching pair in your listing.
Answer:
3. Suppose m = 2 + 6i, and║m+n║= 3√10 , where n is a complex number.
a. What is the minimum value of the modulus of n?
b. Provide one example of the complex number, n.

Answers

Answer:

F.(8-√-11)(8+√-11)

8²-11²i²

8²-121×-1

64+121

=185

G.

(3+i)(2+i)

6+3i+2i+i²

6-1+5i

5+5i

H.

(4+6i)+(-7-7i)

5+6i-7-7i

-2-i

i.

i^24

(i^2)^12

=1

J.

(-3+10i)-(-5+4i)

-3+10i+5-4i

2+6i.

The simplified form of the expressions are 185, G. 5 + 5i, H. -2 - i, I. 1, j. 2 + 6i.

What is a simplification of an expression?

Usually, simplification involves proceeding with the pending operations in the expression.

Like, 5 + 2 is an expression whose simplified form can be obtained by doing the pending addition, which results in 7 as its simplified form.

Simplification usually involves making the expression simple and easy to use later.

F. (8-√-11)(8+√-11)

[tex]8^2 - 11^2 i^2\\8^2 - 121 \times -1\\64+121\\=185[/tex]

G.

(3+i)(2+i)

[tex]6+3i+2i+i^2\\6-1+5i\\5+5i[/tex]

H.

[tex](4+6i)+(-7-7i)\\5+6i-7-7i\\-2-i[/tex]

i.

[tex]i^24(i^2)^12=1[/tex]

J.

[tex](-3+10i)-(-5+4i)\\-3+10i+5-4i\\2+6i.[/tex]

Learn more about expression;

https://brainly.com/question/14083225

#SPJ2

14π
18π
36π
12π
00000000

Answers

The answer is 36TT to the question

What does =] mean in text?

Answers

It typically means that the person is being friendly and is in a good mood.The expression =] is often used as an emoticon to express friendliness, positivity, and happiness. It can be used as a stand-alone expression or as part of a longer sentence.

The expression =] is commonly used in text conversations as an emoticon to express friendliness, positivity, and happiness. It is typically used when a person wants to convey a feeling of warmth and good cheer. The expression can be used as a stand-alone expression or as part of a longer sentence. When used alone, it has a meaning similar to a smiley face and can be used to respond to a message in a positive way. When used as part of a longer sentence, it can be used to express a feeling of contentment. As an emoticon, it has no specific meaning, but it can be used to show that the person is in a positive and good mood. Using this expression can be a way to show that you are happy and in a friendly mood.

Learn more about expression here

https://brainly.com/question/14083225

#SPJ4

What kinds of problems are not solved by algorithms?

Answers

Answer:

Undecidable Problems

Step-by-step explanation:

Ebony owns a dress-making company that sells directly to stores. She charges $14.60 per dress if the store orders up to 40 dresses. For each additional dress ordered after the initial 40 dresses, Ebony takes 1/4 off the original price. If a store bought 56 dresses from Ebony, how much did the store pay?

Answers

Answer:

The store pays $992.80 dollars

Step-by-step explanation:

First we multiply 14.60 by 40.

14.60 x 40 = 584

Next we find out what 14.60 times 1/2 is.

14.60 x 1/2 = 7.3

Then we multiply 56 by 7.3

56 x 7.3 = 408.8

Finally we add both prices.

584 + 408.8 = 992.80

So, the answer is $992.80

Hope this helps! :)

please help me with these questions and show how u got them! i will mark you brainliest

Answers

Step-by-step explanation:

There aren't any like terms in the situations to solve then

Find the measure of the third side. Round your answer to the nearest whole number. ​

Answers

Answer:

20

Step-by-step explanation:

A-c and B-c are the same length and rounded would give you 20

Marking brainliest

Can someone tell me why animal testing is bad?

Answers

The harmful use of animals in experiments is not only cruel but also often ineffective. Animals do not get many of the human diseases that people do, such as major types of heart disease, many types of cancer, HIV, Parkinson's disease, or schizophrenia.

Giving Brainliest! The scatter plot shows the atmospheric carbon dioxide concentration since 2005. Select the correct answers in the drop down menu.

Answers

Answer:

cannot see what is in drop-downs but here are my answers:

risen

428.643

strong positive

highly accurate

Step-by-step explanation:

what is the answer
A
B
C
D

Answers

C the next number is 5
It is C because it can’t be A and it can’t be B and it can’t be D so my answer is C

According to the direct instruction, what is the recommended amount of servings for milk or milk products per day?
a.5 cups
b.3 cups
c.1 cup

Answers

Three glasses of milk or dairy products per day are recommended for adults. One serving of milk is one cup. According to the USDA, a serving of milk-based goods is the amount that corresponds to one cup of milk.

What are dairy products ?

Food items manufactured from (or containing) milk are referred to as dairy products or milk products (also known as lacticinia).

The cow, water buffalo, nanny goat, and ewe are the most popular dairy animals.

Dairy products include staples from Western grocery stores including yogurt, cheese, and butter.

A dairy is a place where dairy products are made .Various amounts of dairy products are consumed worldwide (see consumption patterns worldwide) .

After standardizing the fat content and optional homogenization or pasteurization, milk is produced in a variety of grades with the potential addition of the microorganisms Streptococcus lactis and Leuconostoc citrovorum.

Based on the type of product generated, milk can be divided into a number of distinct categories, including cream, butter, cheese, newborn formula, and yogurt.

Hence, Three glasses of milk or dairy products per day are recommended for adults. One serving of milk is one cup. According to the USDA, a serving of milk-based goods is the amount that corresponds to one cup of milk.

learn more about dairy products click here:

https://brainly.com/question/412166

#SPJ4

Round off 5698 and 8236to the nearest tens.After rounding them off, add them. Then, Round off the sum to the nearest hundred. What do you get?

Answers

Answer:

13900

Step-by-step explanation:

Round off 5698 to it nearest tens

5700

Then Round off 8236 to its nearest tens

8240

Add up 5700 + 8240 = 13940

Round off 13940 to its nearest hundred

13900

At what point does the graph of the linear equation 2x 3y =- 15?

Answers

The graph of the linear equation 2x - 3y = -15 is a line that passes through the point (-5, 5), and has a slope of 2/3.

The linear equation

2x - 3y = -15

can be written in the form

y = mx + b,

where m is the slope and b is the y-intercept. To find the slope of this equation, we can rearrange the equation to be in the form y = mx + b, which gives us

y = (2/3)x - 5.

This means that the slope of the line is 2/3. To find the y-intercept, we can plug in 0 for x and solve for y. This gives us

y = -5.

Therefore, the graph of this equation is a line that passes through the point (-5, 5) and has a slope of 2/3.

Learn more about graph here

https://brainly.com/question/17267403

#SPJ4

solve (2+2)+(4-1). ASAP, it's test​

Answers

??

¯\_(ツ)_/¯

4+3

7

the answer is 7.

Answer:

[tex] \huge \boxed{\displaystyle 7}[/tex]

Step-by-step explanation:

we would like to simplify the following expression:

[tex] \displaystyle (2 + 2) + (4 - 1)[/tex]

in order to do we can consider the order of PEMDAS which is the abbreviation of Parentheses, Exponent, Multiplication,or Division, Addition or substraction

since Parentheses come first we'll simplify parentheses:

[tex] \displaystyle 4 + 3[/tex]

simplify addition:

[tex] \displaystyle 7[/tex]

and we are done!

Can someone please help me with this? and also help me understand how to do it I have a test this Friday.

Answers

The solution to the equation is g = 4π² ( L / T² )

What is an Equation?

Equations are mathematical statements with two algebraic expressions flanking the equals (=) sign on either side.

It demonstrates the equality of the relationship between the expressions printed on the left and right sides.

Coefficients, variables, operators, constants, terms, expressions, and the equal to sign are some of the components of an equation. The "=" sign and terms on both sides must always be present when writing an equation.

Given data ,

Let the equation be represented as A

Now , the value of A is

The formula to determine the time period of a simple pendulum is given by

T = 2π √ ( L / g )   be equation (1)

where L = length of string

g = acceleration due to gravity

On simplifying the equation , we get

Divide by 2π on both sides of the equation , we get

√ ( L / g ) = T / 2π

Squaring both sides of the equation , we get

( L / g ) = T² / ( 2π )²

( L / g ) = T² / 4π²

Now , taking reciprocals on both sides of the equation , we get

g / L = 4π² / T²

Multiply by L on both sides of the equation , we get

g = 4π² ( L ) / T²

On simplifying the equation , we get

g = 4π² ( L / T² )

Therefore , the value of A is 4π² ( L / T² )

Hence , the equation is g = 4π² ( L / T² )

To learn more about equations click :

https://brainly.com/question/19297665

#SPJ1

How do you find the area of the pre image and the image?
Coordinates for the pre-image are X(3,18) Y(18,18) and Z(18,9) and the image coordinates are X’(1,6) Y’(6,6) Z’ (6,3)

and what is the relationship between the two areas?​

Answers

Answer: To find the area of the pre-image and the image, you can use the coordinates of the vertices of the shapes to calculate the lengths of the sides and use the formula for the area of a triangle:

Area = (base * height)/2

For the pre-image, the coordinates are X(3,18) Y(18,18) and Z(18,9). The base of the triangle is the distance between X and Z, which is 18 - 3 = 15. The height of the triangle is the distance between Y and Z, which is 18 - 9 = 9. The area of the pre-image is therefore:

Area = (15 * 9)/2 = 67.5

For the image, the coordinates are X’(1,6) Y’(6,6) Z’ (6,3). The base of the triangle is the distance between X’ and Z’, which is 6 - 1 = 5. The height of the triangle is the distance between Y’ and Z’, which is 6 - 3 = 3. The area of the image is therefore:

Area = (5 * 3)/2 = 7.5

The relationship between the two areas is that the area of the image is smaller than the area of the pre-image. This is because the image has been scaled down in size relative to the pre-image. The amount by which the image has been scaled down can be calculated by dividing the area of the image by the area of the pre-image:

Scale factor = area of image / area of pre-image = 7.5 / 67.5 = 0.11

This means that the image has been scaled down by a factor of 0.11 relative to the pre-image.

Step-by-step explanation:

Answer:

preimage area: 67.5 square unitsimage area: 7.5 square unitsimage area is 1/9 of preimage area, the square of the scale factor

Step-by-step explanation:

You want to know the areas and their relationship of the preimage with coordinates X(3,18), Y(18,18), and Z(18,9), and the image with coordinates X’(1,6), Y’(6,6), Z’ (6,3).

Triangles

When you plot the points on a graph, you see they define right triangles. Each has sides aligned with the x- and y-axes, so it is easy to find their dimensions by counting grid squares or subtracting coordinates.

The preimage triangle is 18-3 = 15 units in the x-direction, and 18-9 = 9 units in the y-direction.

The image triangle is 6-1 = 5 units in the x-direction, and 6-3 = 3 units in the y-direction.

We notice that both the coordinates and the dimensions of the image triangle are 1/3 those of the preimage triangle.

Areas

The area of each triangle is given by the formula ...

  A = 1/2bh

Using the dimensions we found above, the areas are ...

  preimage area: 1/2(15)(9) = 135/2 = 67.5 . . . . square units

  image area: 1/2(5)(3) = 15/2 = 7.5 . . . . square units

Relationship

We have observed that the image dimensions are 1/3 those of the preimage. The image area is 7.5/67.5 = 1/9 of that of the preimage. This value is the square of the scale factor of the dimensions,

18) If you invest $2400 at an annual interest rate of 4.5% that is compounded quarterly, how much will your investment be
worth in 12 years?

Answers

The amount of interest a single deposit earns for the period of one year is equal to your initial investment multiplied by this yield.

What is the formula for calculating investment interest?

Compound interest may be computed using the formula FV = P*(1+R/N)(N*T), where FV is the loan or investment’s future value, P is the original principle amount, R is the yearly interest rate, N is the number of times interest is compounded each year, and T is the period in years.

The amount of interest earned on a single deposit over a year is equal to your initial investment multiplied by this return. As an example: After a year, $1,000 invested at a 5.00% annual effective return yields $50.00 in interest. $1,000.00 x 5.00% = $50.00.

To learn more about Investment and interest to refer:

https://brainly.com/question/14019511

#SPJ1

Logan has 4 2/3 cup of peanuts and 3 2/3 cup of cashews if you combine some nuts how much will he have

Answers

Answer: He will have 8 1/3 nuts

Step-by-step explanation:

Amount of peanuts=4 2/3 cups

Amount of cashews=3 2/3 cups

Combing the nuts will give  Total amount of nuts ( peanuts and cashews)

=4 2/3  +3 2/3

=7  4/3

7 + 1 1/3

8 1/3 nuts

PLease help and the right answer gets marked brainliest!!!!!!!!!!!

Answers

The answer is 382.5! Also I rounded to the nearest tenth. I hope this helps, have a beautiful day!

A team of scientists is developing a computer model to predict the change in average global temperatures over the next 100 years. The model accounts for a wide variety of variables that could affect temperature during this time. Which variable would most likely affect the temperatures that the model predicts

Answers

Scientists are developing a computer model to predict the change in average global temperatures over the next 100 years. The model accounts for a wide variety of variables that could affect temperature during this time.

These variables include:

Carbon dioxide emissions from human activity (x) - This variable is considered to have the greatest impact on temperature predictions as human activities have significantly increased the amount of carbon dioxide in the atmosphere, which is a major greenhouse gas that causes global warming. Carbon dioxide emissions from activities in nature (y) - This variable also plays a role in temperature predictions as it contributes to the overall amount of carbon dioxide in the atmosphere.Global sea level (z) - The time interval is sufficiently large for the global sea level to have a greater impact on temperature predictions as rising sea levels can affect coastal regions and weather patterns.Global rates of photosynthesis (p) - Changes in the Earth's orbital path can affect the global rates of photosynthesis, which in turn can affect temperature predictions.The acidity of ocean water (q) - While the acidity of ocean water is an important variable, it is considered to have a less significant impact on temperature predictions compared to the other variables listed above.

In summary, the variables are ranked in order of their likely impact on temperature predictions, with carbon dioxide emissions from the human activity being the most significant variable, followed by carbon dioxide emissions from activities in nature, global sea level, global rates of photosynthesis, and acidity of ocean water.

To learn more about the variable, visit:

brainly.com/question/29583350

#SPJ4

PLEASE I REALLY NEED HELP!!! DUE SOON

Answers

Answer:

Answer is 69.08 m

Step-by-step explanation:

use formula 2 pie r

radius=diameter/2

=22/2

=11

therefore radius is 11

put the value of radius in the formula 2 pie r

pie=3.14

evaluate the expression 4x^3 if x is 1

Answers

Answer:

Calculate the number of whole years it takes for the population to decrease from 2180 to less than 1000

Step-by-step explanation:

CAN SOMEONE HELP PLEASE !

Answers

Answer:

a= 1

b= 3

c= 1

d= 2

e= 6

f= 8

Step-by-step explanation:

_________

Other Questions
I will be awarding brainliest for anybody who gets it right, 3 new titles for Insurgent and a paragraph describing why The wind force f on a sail varies jointly as the area a of the sail and the square of the wind speed w. The force on a sail with an area of 500 ft^2 is 64. 8 pounds when the wind speed is 18 mph. What would be the force for a sail with an area of 250 ft^2 with a wind speed of 35 mph Are Tropical rain forests are typically located close to the equator? plane flew from Red Deer to Winnipeg, a flying distance of 1260 km. On the return journey, due to a strong head wind, the plane travelled 1200 km in the same time it took to complete the outward journey. On the outward journey, the plane was able to maintain an average speed 20 km/hr greater than on the return journey. Calculate the average speed of the plane from Winnipeg to Red Deer. To pay for a $15,900 car, Donna made a down payment of $4800 and took out a loan for the rest. On the loan, she paid monthly payments of $245.70 for 4years.(a) What was the total amount Donna ended up paying for the car (includingthe down payment and monthly payments)?(b) How much interest did Donna pay on the loan? Is this correct? I can't figure out if this is, So please answer. streamlined transportation vehicle with 2 openings and glass windows. It appears to run on some kind of track.Predict what the text will be about based on this image?a.future transportationc.both of theseb.public transportationd.neither of these Sam has always been able to pick up new languages easily. What quality does she have that helps her do this?soft skills.self-awarenesscompetencyability What baseball stat does Lawrence Hinman suggest is the most important stat for determining the best player in the game in a given year Where should the comma go in the following sentence **You should not need to round on this problem, no %'s decimals only**At Houston Community College 60% of the students who take English will pass. Of those who pass English, 70% will also pass Accounting. Of those that do not pass English, 45% will still pass accounting. How do you find the 3rd side of a triangle? Select the correct answer. Which graph represents the solutions to this equation? x2 + 8x = -20 A. Linear-quadratic system graph shows upward parabola with vertex at (minus 2, 4) and passing through x and y-axis (minus 8, 0), and (0, 0) B. Linear-quadratic system graph shows upward parabola with vertex at (minus 4, 4) and passing through (minus 2, 8), and (minus 6, 8) C. Linear-quadratic system graph shows upward parabola with vertex at (4, 0) and passing through (1, 4), and (6, 4) D. Linear-quadratic system graph shows a downward parabola with vertex at (0, 8) which intercepts the x-axis at 3 and minus 3 units. Lila swam 50 meters north in 10 seconds. Find Lila's velocity TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets. True/False: Money is more important than finding something you're going to lovedoing. Select the correct answer.Which of these is an example of elemental carbon?A. DiamondB. MethaneC. Proteins 6 less than 3 times a number 42 what is the number Two numbers total 31 and have a difference of 9. Find the two numbers. Can someone help me with this question?