WILL MARK BRAINLIEST IF ANSWERED!!! How do scientists think endosymbiosis might have occurred?
A. Eukaryotes preyed on prokaryotes.
B. Prokaryotes actively absorbed eukaryotes through their
membranes.
C. Eukaryotes actively absorbed prokaryotes through their
membranes.
D. Eukaryotes and prokaryotes mated.

Answers

Answer 1

Answer:

hope this helps some

Explanation:

The theory that explains how this could have happened is called endosymbiotic theory. An endosymbiont is one organism that lives inside of another one. All eukaryotic cells, like your own, are creatures that are made up of the parts of other creatures. Mitochondria, the important energy generators of our cells, evolved from free-living cells.


Related Questions

What does metabolically inert mean? "Sucrose is soluble but metabolically inert"

Answers

Metabolik olarak inert ne anlama geliyor? "Sakkaroz çözünür ancak metabolik olarak etkisizdir"
Derslerinde başarılar dilerim

Viruses are metabolically inert and incapable of reproducing independently of a host cell (hence are non-living).

What is meant by metabolically inert?Viruses are metabolically inert and incapable of reproducing independently of a host cell (hence are non-living). They typically consist of an inner core of nucleic acid surrounded by a protein coat (capsid). Simpler viruses may lack a capsid (viroids), whilst more complex viruses may possess an external lipid envelope.

Viruses are metabolically inert and incapable of reproducing independently of a host cell (hence are non-living).

To learn more about metabolically inert refer:https://brainly.com/question/1229016

#SPJ2

What roles do humans play in the carbon cycle?

Answers

Answer:

Humans affect the carbon cycle by burning fossil fuels and cutting down trees. Car exhausts and factory emissions produce a lot more CO2 in the atmosphere!

Explanation:

HOPE THIS HELPS:)

What is the carrying capacity (approx)?

Answers

Answer:

ecological terms, carrying capacity is defined as the maximum number of a species that can sustainably live in a given area.

when a chicken with black feathers mates with a chicken with white feathers, their offspring may be a speckled hen. Half of a speckled hen's feathers are black and the other half are white. This is an example of:

A. multiple alleles

B. simple dominance

C. Codominance

D. incomplete dominance

Answers

i’m pretty sure it’s C. Codominance

Answer:

codominance

Explanation:

1. Blood flowing through the aorta is distributed to all parts of
the body, except the:
A. lungs.
B. small intestine.
C. heart.
D. brain.​

Answers

Answer:

I think d . brain must be the ans

What are some common characteristics that infectious agents like viruses, bacteria, fungi and parasites have in common? What are some differences?

Answers

Bacteria. These one-cell organisms are responsible for illnesses such as strep throat, urinary tract infections and tuberculosis. Viruses. Even smaller than bacteria, viruses cause a multitude of diseases ranging from the common cold to AIDS. (Here is some that I found.)

Which pair of objects has the largest gravitational force?
a- car and bowling ball
b- marble and baseball
c- There is no gravitational force between any of these pairs of objects.
d-marble and can

Answers

Answer:a

Explanation: they are bigger they take up more space and heavier so the pull of gravity is stronger because of that

Which phrase is appropriate for an advertisement for a health service?
"new discovery"
"FDA-approved''
"amazing results"
"European"

Answers

The answer would be amazing results

Answer:it’s FDA-approved

Explanation:

Don’t do amazing results it’s wrong I took the test

What are 2 things to all cells have?

Answers

Answer:

All cells have CYTOPLASM and DNA.

Explanation:

my answer got deleted.

can anyone help me with this question? whoever answers first gets brainliest!

Answers

Answer:

A is the most likely

Explanation:

What is the function of epithelial cells?

Answers

Answer:

Pretty much everything that goes on inside ur body

Explanation:

Epithelial tissues are widespread throughout the body. They form the covering of all body surfaces, line body cavities and hollow organs, and are the major tissue in glands. They perform a variety of functions that include protection, secretion, absorption, excretion, filtration, diffusion, and sensory reception.

what properties of carbon explain carban's ability to form different large and complex structure?​

Answers

Sick icijdnxn I. N I I j. Snap

what is the name of the process where plants water from their leaves?

Answers

Answer:

Transpiration

Explanation:

Transpiration That’s that

Place the answer below for the Deck Toys completion (two words)
If you do K12, you might know this

Answers

Answer:

What are the word options?

Explanation:

Hibernation is an example  of A physical or structural adaptation .
True or false

Answers

False , only camouflage is a physical adaptation

Answer:

yea false

Explanation:

Why does oxygen from our lungs diffuse into the bloodstream?

Answers

Answer:

so we can breath duh

Explanation:

Drop a paper, a piece of thermopol, and a piece of plastic from a height of 10-15 feet. Note the time for each object to hit the ground. Why does the paper take more time than thermopol and thermopol more than the plastic piece? Make the paper to fell down in such a way that it should hit the ground before all of them. How did it happen? Explain.

Answers

It took the paper longer because is has a lot of surface area that air can resist to and push up, making it float slowly to the floor rather then drop quickly. The piece of plastic is also more aerodynamic than the piece of paper because the air wont have as much surface area to resist to.

We folded it into a paper airplane. We did this so that it will be more aerodynamic.

Correct me if I’m wrong.



It took the paper longer as it has quite a few surface places that air can withstand and push up, making it glide slowly to the ground rather than drop fast. The piece of plastic is likewise extra aerodynamic than the piece of paper because the air won't have as an awful lot of floor regions to face up to.

What is aerodynamic in simple terms?

Aerodynamics is the way air actions around matters. The guidelines of aerodynamics give an explanation for how an aircraft is capable of fly. whatever that movements through air reacts to aerodynamics. A rocket blasting off the launch pad and a kite within the sky react to aerodynamics. Aerodynamics even acts on vehicles, considering that air flows around motors.

What is an aerodynamic example?

Aerodynamics is the way air moves around matters. given that air is all around us, there are many examples of aerodynamic technology other than for aircraft. take a look at golf balls for instance. golfing balls have their unique shape with loads of dimples on them to improve their aerodynamics and create more lift.

Learn more about Aerodynamics at https://brainly.com/question/4702501

#SPJ2

Pea plants can have alleles for being tall or for being short. A pea plant has one allele for being tall, and one allele for being short. When it grows, it ends up being a tall plant.

because of this what do we know is true about pea plant alleles?

A. being short is a dominant allele

B. All pea plants must be short

C. All pea plants must be
tall

D. Being tall as the dominant allele

Answers

Answer:

D

Explanation:

the dominant traits tends to be the one shown

NEED HELP VERY SIMPLE WILL MARK BRAINLIEST THANKS

Answers

Answer:

The organism

Explanation:

Answer:

last one and the second

Explanation:

URGENT! HIGH POINTS
Match the following. Each word should be used only one time.
Colossians, deductive, defined, inductive, observations, Romans.


Science deals with __________________ of the physical world.

___________________ reasoning is the process of applying a rule.

___________________ reasoning starts with facts and works toward general conclusions. It is the process of finding a rule.

The statement “2+2=4” can be classified as a _________________ truth.

Christians should try hard to understand science, so that they are not deceived by hollow and deceptive philosophies (__________________ 2:8)

We can improve our relationship with God by studying His creation (____________1:20).

Answers

Answer:

A  Observations  B Deductive  C Inductive  D: Defined  E Colossians  F Romans

Explanation:

What happens when an organism is eaten? A. All of its energy is returned to producers. B. All of its energy is gone when it dies and cannot be reclaimed by the ecosystem. C. A small portion of its energy is absorbed by the consumer, the rest is transformed into heat or waste. D. All of its energy is absorbed by the consumer.

Answers

Answer:

The higher organisms eat the lower organisms, break down their matter and rearrange the molecules to make their own matter. When any organism dies, the remains are broken down and put back into the cycle as inorganic molecules. Each of these organisms eat organic matter to produce energy and small pieces of matter.

Who coined the word 'antibiotic'?

Answers

Answer:

Selman Waksman, the microbiologist who discovered streptomycin, first used the word "antibiotic" in the medical sense in 1943. Science historian Howard Markel talks about how it was actually a naval officer who first coined "antibiotic" in 1860, to describe an opposition to the belief in life beyond Earth.

If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?

Answers

UACCGCUCCGCCGCUCGACAAUACC

Why are cells so small?

Answers

Answer:

Why are cells small? because they can absorb nutrients much more efficiently. Because they are smaller they can efficiently absorb enough food. When a cell doubles in size the volume increases much more then the surface area, which is why large cells cannot receive enough food efficiently for their volume.

Hope this helped :)

What is the orgenlle that takes place in photosynthesis

Answers

Answer:

chloroplast

Explanation:

Location X is next to Location Y and they are both much colder than Location Z. Which statement is most likely true? a Locations X and Z are at the poles. b Locations X and Y are at the poles. c Locations X and Z are at the equator. d Locations X and Y are at the equator. WILL MARK BRAINLIEST

Answers

B locations X and Y are at the poles

Will give brainliest to whoever gets it right at the end of my exam :))

Answers

Answer:

#3

Explanation:


3. The diagram to the right shows a flower.
Which parts of the flower are male reproductive
structures?
A. parts A and B
B. parts C and D
C. parts E and F
D. parts D, E, and F

Answers

Answer:

A. parts A and B

Explanation:

A is the filament and B is the anther

In this diagram below , which of the stomach tissues would be muscular tissues ?


- tissue 1 : forms the outer lining of the stomach


-tissue 2 : produces enzymes which are secreted into the stomach cavity


- tissue 3 : cells in this tissue contract to churn the contents of the stomach


In a numeric number

Answers

Tissue 1 which forms the outer lining of the stomach would be the muscular tissues.

What is Muscularis mucosa?

This is referred to as the outermost layer of the mucosa and comprises of elastic fibers and smooth muscle cells.

The muscular tissue is therefore tissue 1 as a result of its location and function in the body.

Read more about Muscular tissues here https://brainly.com/question/2648088

#SPJ1  

PLEASE HELP ME NOW!!!!!!!!!!!
(02.03 HC)
Examine the layers of rock. Identify and explain which layer contains the youngest fossils. (3 points)

Answers

Answer:

A

Explanation: A is the youngest bestie <3333

Answer:

A

Explanation:

Because it is at the top

Other Questions
In the liner equation shown which variable represent the output valuesY= MX + b an author writes a story about a teenager who does not realize how conscious to others. What would be the best object to symbolize that the character cannot see her true self? 0.12g of rock salt was dissolved in water and titrated with 0.1moldm^-3 silver nitrate until the first permanent brown precipitate of silver chromate is seen. 19.70 cm^3 was required to titrate all the chloride ion. how many moles of chloride ion were titrated? what mass of sodium chloride was titrated? what was the % purity of the rock salt in terms of sodium chloride? Find the value of X. round to the nearest tenth Henri brought a swim suit at a cost of $8. Which statements are true regarding the cost of the suit? Select three options. If the selling price is marked up by 25 percent, the new price will be $10.If the selling price is marked up by 40 percent, the new price will be $7.50.If the selling price is marked up by 55 percent, the new price will be $5.50.If the selling price is marked up by 70 percent, the new price will be $13.60.If the selling price is marked up by 75 percent, the new price will be $14. Which resource is abundant in Wyoming? A- iron B- coal C- timber D-citrus fruits 40 points- Which statement best evaluates the effectiveness of this conclusionparagraph?( pic above )answer choices 1. this conclusion is ineffective because it fails to provide a satisfying close.2. this conclusion is ineffective because it is not summarize the main points of the essay.3. this conclusion is effective because it restates The thesis statement in a new way. 4. this conclusion is affective because it adds new information not addressed in the main points. Find the highest common factor (HCF) of 90 and 48. Liam bought 2 vintage movie posters, 2 rock posters, and 1 rap poster. He applied a $35 gift card to the total purchase and a 1/2-off coupon to the rap poster. Write and evaluate a numerical expression to show how much Liam paid for the posters.Vintage Movie: $28.50B Movie: $18.25Rock: $29.75Rap: $19.50 Tips to identify email scams. What is the sum of 66 and its opposite?A. 1212B. 66C. 0 D. 66 Write the point-slope form of the equation of the line through the given point and slope.through: (1, -2), slope = -6y - 2 = -6 (x + 1)y - 2 = 6 (X + 1)y + 2 = -6 (x - 1)y + 2 = 6 (x - 1) Is this sentence in active voice or passive voice?Pride and Prejudice was written by English author Jane Austen in the late 1700s. To what does Crevecoeur mainly attribute the metamorphosis of character he notes among the settlers in colonies? Multiple choiceI genuinely have no idea-- but I don't think it's the first one or the last. I think it may be the third one but I'm not too sure. What is the quotient of 3.12 Divided 6.5. A) 0.048 B) 0.48 C)4.8 D)48 Which of the following tasks would require the most bandwidth?I am marking Brainliestsending a text messageuploading pictures to an online photo storeuploading film to a digital editing stationdownloading an album from a music sharing site Where does "nicht" come in a sentence?before the verbafter the verbbefore the first objectbetween the first and (if present) the second object Jolly Middle School is building a park, in the shape of a square, with an area of 256 square feet. How much fence do they need to buy to close in the park? p-1p=5 then p2-1p2=? finda the value of p Steam Workshop Downloader