Which of the following lists identifies organisms that are producers in food webs?(20 points and multiple choice)

A. algae, grass, sunflowers
B. mushrooms, bacteria, earthworms
C. termites, fleas, ticks
D. grasshoppers, lichen, venus fly traps

Answers

Answer 1

Answer:

A

Explanation:

Algae, grass, and sunflowers all produce their own food since they can't consume anything.

Answer 2

i feel like its B. sorry if im wrong


Related Questions

Monkeys have a prehensile tail that allows them to grab and hold onto tree branches.

Answers

Answer:

structural adaptation

Explanation:

Adaptation is the way the organism is kept alive in changing life circumstances. Every organism in a dynamic relationship with the environment tends to survive.

Ecological factors determine the living conditions in one habitat. This means that all plants, animals, fungi, and even microorganisms adapt to the conditions

I will mark brainest if you get it right
Which of these is a practice that sustains or conserves natural resources?
A. Leaving the TV on all day
B. filling the bathtub to the top
C. recycling cans
D. burning newspapers

Answers

Answer:

C recycling cans

Explanation:

What does metabolically inert mean? "Sucrose is soluble but metabolically inert"

Answers

Metabolik olarak inert ne anlama geliyor? "Sakkaroz çözünür ancak metabolik olarak etkisizdir"
Derslerinde başarılar dilerim

Viruses are metabolically inert and incapable of reproducing independently of a host cell (hence are non-living).

What is meant by metabolically inert?Viruses are metabolically inert and incapable of reproducing independently of a host cell (hence are non-living). They typically consist of an inner core of nucleic acid surrounded by a protein coat (capsid). Simpler viruses may lack a capsid (viroids), whilst more complex viruses may possess an external lipid envelope.

Viruses are metabolically inert and incapable of reproducing independently of a host cell (hence are non-living).

To learn more about metabolically inert refer:https://brainly.com/question/1229016

#SPJ2

URGENT! HIGH POINTS
Match the following. Each word should be used only one time.
Colossians, deductive, defined, inductive, observations, Romans.


Science deals with __________________ of the physical world.

___________________ reasoning is the process of applying a rule.

___________________ reasoning starts with facts and works toward general conclusions. It is the process of finding a rule.

The statement “2+2=4” can be classified as a _________________ truth.

Christians should try hard to understand science, so that they are not deceived by hollow and deceptive philosophies (__________________ 2:8)

We can improve our relationship with God by studying His creation (____________1:20).

Answers

Answer:

A  Observations  B Deductive  C Inductive  D: Defined  E Colossians  F Romans

Explanation:

can anyone help me with this question? whoever answers first gets brainliest!

Answers

Answer:

A is the most likely

Explanation:

Pea plants can have alleles for being tall or for being short. A pea plant has one allele for being tall, and one allele for being short. When it grows, it ends up being a tall plant.

because of this what do we know is true about pea plant alleles?

A. being short is a dominant allele

B. All pea plants must be short

C. All pea plants must be
tall

D. Being tall as the dominant allele

Answers

Answer:

D

Explanation:

the dominant traits tends to be the one shown

Who coined the word 'antibiotic'?

Answers

Answer:

Selman Waksman, the microbiologist who discovered streptomycin, first used the word "antibiotic" in the medical sense in 1943. Science historian Howard Markel talks about how it was actually a naval officer who first coined "antibiotic" in 1860, to describe an opposition to the belief in life beyond Earth.

NEED HELP VERY SIMPLE WILL MARK BRAINLIEST THANKS

Answers

Answer:

The organism

Explanation:

Answer:

last one and the second

Explanation:

What is the animal organelle name
order 1-15.

Answers

Answer:

I dunno

Explanation:

If a red blood cell is placed in pure distilled water, what do you expect to occur?


Group of answer choices
The cell will remain the same size
The cell will swell and burst
The cell will shrink
None of these

Answers

Answer:

The cell will swell and burst due to the hypotonic solution

Explanation:

What roles do humans play in the carbon cycle?

Answers

Answer:

Humans affect the carbon cycle by burning fossil fuels and cutting down trees. Car exhausts and factory emissions produce a lot more CO2 in the atmosphere!

Explanation:

HOPE THIS HELPS:)

What are some common characteristics that infectious agents like viruses, bacteria, fungi and parasites have in common? What are some differences?

Answers

Bacteria. These one-cell organisms are responsible for illnesses such as strep throat, urinary tract infections and tuberculosis. Viruses. Even smaller than bacteria, viruses cause a multitude of diseases ranging from the common cold to AIDS. (Here is some that I found.)

In this diagram below , which of the stomach tissues would be muscular tissues ?


- tissue 1 : forms the outer lining of the stomach


-tissue 2 : produces enzymes which are secreted into the stomach cavity


- tissue 3 : cells in this tissue contract to churn the contents of the stomach


In a numeric number

Answers

Tissue 1 which forms the outer lining of the stomach would be the muscular tissues.

What is Muscularis mucosa?

This is referred to as the outermost layer of the mucosa and comprises of elastic fibers and smooth muscle cells.

The muscular tissue is therefore tissue 1 as a result of its location and function in the body.

Read more about Muscular tissues here https://brainly.com/question/2648088

#SPJ1  

Which process is part of transcription?

DNA is copied to create a second DNA strand.
mRNA codons and tRNA anticodons assemble amino acids.
DNA is unzipped with the aid of DNA polymerase.
mRNA is synthesized from a strand of DNA.

Answers

Answer:DNA is copied to create a second DNA strand.

Explanation:Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA molecule. ... RNA polymerase uses one of the DNA strands (the template strand) as a template to make a new, complementary RNA molecule. Transcription ends in a process called termination.

Answer:A

Explanation:

1. Blood flowing through the aorta is distributed to all parts of
the body, except the:
A. lungs.
B. small intestine.
C. heart.
D. brain.​

Answers

Answer:

I think d . brain must be the ans

what is the form of energy that the body use doing the rest​

Answers


The rate at which the body uses food energy to sustain life and to do different activities is called the metabolic rate.

Please help with this.

Kai lives on the island of Hawaii, and sometimes thin, runny lava actually flows from the volcanoes there. What type of volcanoes are on that island?

A. active
B. dormant
C. extinct
D. explosive

Answers

Answer:

A. Active

Explanation:

A. active.
dormant means “hibernation” in a sense so it’s “asleep” until a certain time.
extinct means it doesn’t erupt no more.
explosive is a very violent eruption.

Which phrase is appropriate for an advertisement for a health service?
"new discovery"
"FDA-approved''
"amazing results"
"European"

Answers

The answer would be amazing results

Answer:it’s FDA-approved

Explanation:

Don’t do amazing results it’s wrong I took the test


3. The diagram to the right shows a flower.
Which parts of the flower are male reproductive
structures?
A. parts A and B
B. parts C and D
C. parts E and F
D. parts D, E, and F

Answers

Answer:

A. parts A and B

Explanation:

A is the filament and B is the anther

Why does oxygen from our lungs diffuse into the bloodstream?

Answers

Answer:

so we can breath duh

Explanation:

what properties of carbon explain carban's ability to form different large and complex structure?​

Answers

Sick icijdnxn I. N I I j. Snap

Place the answer below for the Deck Toys completion (two words)
If you do K12, you might know this

Answers

Answer:

What are the word options?

Explanation:

where is the mRNA located in prokaryotes?
a. in the nucleolus
b. outside the nucleus
c. inside the nucleus
d. in the cytoplasm

Answers

Explanation:

RNA is located in

a)inside the nucleus

D prokaryotes don’t have nucleus! Nucleus is a membrane-bounded organelle

what is the name of the process where plants water from their leaves?

Answers

Answer:

Transpiration

Explanation:

Transpiration That’s that

Why are cells so small?

Answers

Answer:

Why are cells small? because they can absorb nutrients much more efficiently. Because they are smaller they can efficiently absorb enough food. When a cell doubles in size the volume increases much more then the surface area, which is why large cells cannot receive enough food efficiently for their volume.

Hope this helped :)

Hibernation is an example  of A physical or structural adaptation .
True or false

Answers

False , only camouflage is a physical adaptation

Answer:

yea false

Explanation:

Drop a paper, a piece of thermopol, and a piece of plastic from a height of 10-15 feet. Note the time for each object to hit the ground. Why does the paper take more time than thermopol and thermopol more than the plastic piece? Make the paper to fell down in such a way that it should hit the ground before all of them. How did it happen? Explain.

Answers

It took the paper longer because is has a lot of surface area that air can resist to and push up, making it float slowly to the floor rather then drop quickly. The piece of plastic is also more aerodynamic than the piece of paper because the air wont have as much surface area to resist to.

We folded it into a paper airplane. We did this so that it will be more aerodynamic.

Correct me if I’m wrong.



It took the paper longer as it has quite a few surface places that air can withstand and push up, making it glide slowly to the ground rather than drop fast. The piece of plastic is likewise extra aerodynamic than the piece of paper because the air won't have as an awful lot of floor regions to face up to.

What is aerodynamic in simple terms?

Aerodynamics is the way air actions around matters. The guidelines of aerodynamics give an explanation for how an aircraft is capable of fly. whatever that movements through air reacts to aerodynamics. A rocket blasting off the launch pad and a kite within the sky react to aerodynamics. Aerodynamics even acts on vehicles, considering that air flows around motors.

What is an aerodynamic example?

Aerodynamics is the way air moves around matters. given that air is all around us, there are many examples of aerodynamic technology other than for aircraft. take a look at golf balls for instance. golfing balls have their unique shape with loads of dimples on them to improve their aerodynamics and create more lift.

Learn more about Aerodynamics at https://brainly.com/question/4702501

#SPJ2

If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?

Answers

UACCGCUCCGCCGCUCGACAAUACC

What is the orgenlle that takes place in photosynthesis

Answers

Answer:

chloroplast

Explanation:

What is the carrying capacity (approx)?

Answers

Answer:

ecological terms, carrying capacity is defined as the maximum number of a species that can sustainably live in a given area.

Other Questions
Help. Please look at the picture. Thanks. The sum of three consecutive numbers is 72 what is the smallest of the numbers type the correct answer in the box. Spell all words correctly. Which element of the presentation software can you use to add callouts and banners? using ____, you can add callouts and banners to a slide A scuba diver is 3 meters below sea level. If the diver descends another 8 meters, what is the scuba divers position? Writer Henry James argued that Emerson had no concept of the evil that exists in the world. In James's words, it was "a side of life as to which Emerson's eyes were thickly bandaged. . . . He had no great sense of wrong . . . No sense of the dark, the foul, the base." In your opinion, is this a valid criticism of Emerson? Explain why or why not, using at least 1 direct quote from "Nature" in your response.. what's the last planet on solar system? Suppose that a new employee starts working at $7.72 per hour and receives a 4% raise each year. After time t, in years, his hourly wage is given by the equation y=$7.72(1.04)t. Find the amount of time after which he will be earning $10.00 per hour. it is an injury or disability caused when the normal position of a joint or other partnof the body is disturbed find the amount on #45,000 in 3 years at 10% per annum and also find the compound interest the mean of a,b,c,and d is 9 and the mean of a,b,c,d,e and f is 12. find the mean of e and f HELP FAST PLEASEWhat is the layout of a narrative? Can somebody give me an example..Lets imagine we live in a society where there is no money. All of your basic needs are met and you can choose to do whatever youd like. Maybe its something that contributes to society or maybe its something you just like to do. What would you do? Why did the Articles of Confederation have to be replaced by the Constitution? Please answer I really need help!! True or False A house Manager manages all ticket sales? Which statement describes the graph of function g?f(x) = 2xg(x) = 2x + 3The graph of g is 3 units to the left of the graph of f.The graph of g is 3 units below the graph of f.The graph of g is 3 units above the graph of f.The graph of g is 3 units to the right of the graph of f. First term: 2 3/4 sixth term: 3 7/12 please urgent please beg Simplify -6.204131848318 what is the area of a shaded region in the quarter circle radius 12 Steam Workshop Downloader