what is the approximate size of the chloroplast genome in base pairs?

Answers

Answer 1

Answer:

between 115 and 165 Kb

Explanation:


Related Questions

An organ that makes and secretes hormones is called a
1] lung
2]gland
3]pancreas
4]thyroid

Answers

Answer: 2]gland brainliest?

Explanation:

Enumerate ways on how humans produce sound:Ex:clapping your hands
a.__________________________
b.__________________________
c.__________________________
d.__________________________
e.__________________________

Answers

Answer:

vibrating vocal cords, stomping feet, gargling, whistling, cracking your knuckles

Answer:

•shouting•talking•singing•playing instruments•laughing•yelling•screaming•crying

Explanation:

yAn LNG po Alam ko e:^

Why is it we cannot directly observe a genotype, but can sometimes infer it?

Answers

We cannot directly observe a genotype because there are multiple options for genotypes.

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Answers

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

How can the appearance of white baby rabbits be explained when the mother has white fur, and the father has black fur?

Answers

Explanation:

because the baby rabbit took after its mother and the

PLZ HELP ME!!!!
2. What happens to sedimentary rocks on Earth’s surface?

Answers

Answer:

Sedimentary rock can change into metamorphic rock or into igneous rock. ... On Earth's surface, wind and water can break rock into pieces. They can also carry rock pieces to another place. Usually, the rock pieces, called sediments, drop from the wind or water to make a layer

Explanation:

Answer:

Sedimentary rocks are formed on or near the Earth's surface, in contrast to metamorphic and igneous rocks, which are formed deep within the Earth. ... Erosion and weathering transform boulders and even mountains into sediments, such as sand or mud. Dissolution is a form of weathering—chemical weathering.

Explanation:

Which of the following contain stem cells that produce most types of blood cells?
Bone Marrow
O Muscle cells
O Bile
O Plasma

Answers

Bone marrow produces many types of white blood cells.

Hello! could someone please do a 4 sentence quark poem

Answers

Answer:

Quark is a character in the television series Star Trek: Deep Space Nine.

Quark developed a few strong friendships during his stay on Deep Space Nine.

The Ferengi have business deals throughout the galaxy; Quark is no different.

For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.

Explanation:

During fertilization, sperm cells will either contain an x or a y chromosome in addition to 22 other chromosomes, totaling______

Answers

The answer is A because

How about decreasing the amount of water in blood affect blood pressure

Answers

Answer:

When you're very dehydrated, your blood volume can decrease, leading to a drop in blood pressure. When blood pressure drops too low, your organs won't receive the oxygen and nutrients they need. You could potentially go into shock.

If you find a fossil in two different locations and it has featured in common with dinosaurs and modern birds, how does this support the evolutionary theory?

a) the two species must not be related
b) looking at the fossils, they show similarities both physically and in their DNA that don't appear to change much over time
c) dinosaurs must have evolved from mammals because their bones are similar in size rather than birds
d) the land must have been together at one point where these two species interbred to share a common ancestor

Answers

Answer: D

Explanation: the continents wee once connected. It was known as Pangea

what does not pass through the stomata of leaves ​

Answers

Carbon dioxide and oxygen cannot pass through but move in and out

Someone please help me !

Answers

Answer:

A

Explanation:

A becouse planets do move and the sun move around eachother.

need help, will mark brainliest! plsss.
Which of the following is *not* a physiological mechanism regulated by timing?

Circadian rhythms in eukaryotes
Hibernation of animals during winter
Photoperiodism to direct the flowering of plants- i think its this one
Viral reproduction in a host cell

Answers

Hello, I Am BrotherEye

Answer: Physiological mechanisms explain any health-related events or outcomes. Physiological mechanisms can be altered voluntarily. For example, exercise causes alteration in the cardiac physiology of resting state. ... Multiple physiological mechanisms are responsible for survival of an individual.

Explanation:

It Is Simple Find The Answer Choice That Is The Opposite Of The One Above

In the 1960s, homeostatic regulatory mechanisms in physiology began to be used to describe what normally happens to the value of the regulated variable over time. The body does not possess a physiological sensor for detecting these

I hope that this helps

meaning of cell or cytology​

Answers

Answer:

the smallest structural and functional unit of an organism, typically microscopic and consisting of cytoplasm and a nucleus enclosed in a membrane.

Explanation:

Cell is the building blocks of life.

Hat percent of electricity in the UK will come from renewable sources by 2010? a. 1% c. 10% b. 5% d. 40%

Answers

Answer:

C, 10%

Explanation:

For the year of 2010, it's definitely 10%

Help me with this please

Answers

C can be the possible answer!

Which technique will researchers studying the inheritance patterns of various disorders most likely use? A. CLADOGRAM, B. DNA FINGERPRINTING, C. GEL ELECTROPHORESIS, D. CHROMOSOMAL ANALYSIS

Answers

Answer:

Chromosomal Analysis

Explanation:

Most of the options are pretty superficial but chromosomal analysis goes in depth therefore you'll get more results and find what could potentially be wrong.

The fan illustrated here plugs into the wall and blows air to make a room cool.




Which of the following best explains how it works?
A: It reduces heat by producing sound energy.

B: It gets chemical energy from gases in the air.

C: It transform electrical energy into the energy of motion.

D: It spins, sending heat and light energy through its wires.

Answers

Answer:

The only logical answer is C, the other ones don't make sense

Explanation:

I hope this helps! :)

What would happen if there is an obstruction in the vas deferens?​

Answers

A transfer of sperm to a female

At the core of the differences between gender and sex is the chromosomal information transmitted at the moment a child is conceived. An "XY" chromosome generally means A) a heterosexual embryo B) a male embryo C) a hermaphrodite embryo OD) a female embryo​

Answers

Answer:

B) male embryo

Explanation:

Tell me if you think caecilians are amphibians, reptiles, or fish.

Answers

Answer:

Amphibians

Explanation:

State one way by which Carbon Dioxide decreases in the atmosphere

Answers

Answer:

The early atmosphere was mainly carbon dioxide and water vapour. Water vapour condensed to form the oceans. Photosynthesis caused the amount of carbon dioxide to decrease and oxygen to increase.

Hope it helps!!!

Earth's crust is a thin layer made of
a rock
b metal
c liquid metal
d water

Answers

B!!!!!!!!!!!!!!!!!!!

Answer:

a

Explanation:

give an example of something that might stop a cell from checking things during the cell cycle

Answers

Answer:

A checkpoint is one of several points in the eukaryotic cell cycle at which the progression of a cell to the next stage in the cycle can be halted until conditions are favorable. ... The G2 checkpoint ensures all of the chromosomes have been replicated and that the replicated DNA is not damaged before cell enters mitosis.

A mutation in a tumor suppressor gene may stop a cell from checking things during the cell cycle.

Tumor suppressor genes are normally expressed genes that control the progression of a cell through the cell cycle.

These genes (tumor suppressor genes) act to repair mutations that occurred during DNA replication, slow down cell division, activate programmed cell death pathways (i.e., apoptotic pathways, etc).

For example, p53 is a tumor suppressor gene capable of controlling cell division rate by keeping cells from proliferating in an uncontrolled manner.

In consequence, mutations of the p53 gene are often observed in cancer cells that lost their ability to regulate the rate at which they grow.

In conclusion, a mutation in a tumor suppressor gene may stop a cell from checking things during the cell cycle.

Learn more in:

https://brainly.com/question/16188646

A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statements is supported by the phylogenetic tree shown here? Select ALL that apply.
A) M. bicolor and M. parma are in the same subspecies category. Eliminate
B) M. agilis and M. eugenii share the most recent common ancestor.
C) T. thetis and P. xanthpus share the most characteristics in common.
D) T. thetis and P. xanthpus share the greatest number of taxa levels than other species.
E) M. agilis and M. eugenii share the greatest number of taxa levels than other species.

Answers

Answer: B and E

Explanation: USATESTPREP

What are the goals of binomial nomenclature and systematics?

Answers

Answer:

The goal of systematics is to organize living things into groups that have biological meaning. the science of naming and grouping organisms.

Explanation:

1. Place the letters in the correct order for DNA replication (a, b, c): ___
a. Daughter strands are formed using complementary base pairing.

b. DNA unwinds

c. The DNA of the daughter strands winds together with its parent strand.
2.Why is DNA replication called “semi-conservative”? ___
3.What enzyme unwinds or unzips the parent strand? ___
4.What enzyme connects the new bases to the old bases in the DNA template? ___
5.___DNA replication results in two DNA molecules,

a. each with two new strands

b. one with two new strands and one with 2 original strands

c. each with two original strands
d. each with one new strand and one original strand

6.___DNA replication is said to be semiconservative because:

a. both RNA and DNA synthesis are involved in the process.

b. part of the telomere is lost during each round of replication.

c. a new double helix contains one old and one new strand.

d. each new strand is complementary, not identical, to its template

Answers

Explanation:

1. b-a-c

2. Because in each of the new pair of double stranded DNA formed after replication, a parent strand is present in each.

3. Helicase

4. DNA Polymerase

5. Option D

6. Option C

HELLHELEPEGELLHELLPPPPPPPPP help please

If an acorn falls off a tree, is it living or non-living??

Answers

Answer: living

Acorns are still alive even off the tree and eventually grow into plants in the right conditions.

Answer:

Acorns are alive. Acorns live and breathe. Since they have no teeth and claws, acorns defend themselves with have chemicals called tannins. Because acorns decompose slowly, some gardeners compost them separately from other materials that break down more rapidly. Others grind them before composting them, as this speeds up decomposition.

therefore they are still living

Explanation:

brainliest?

Essay Question: Which two species are more closely related?

Answers

Answer:

mannimals;humens and animals

Explanation:

Other Questions
Which of these is a line segment? PLS HELP 1. Mt. Everest is __________ (extreme) difficult to climb.2. The workers __________ (convince) their boss to give them a day off.3. The __________ (major) of people in the Middle East speak Arabic.4. The country is __________ (divide) over the recent elections.5. Students __________ (tradition) wear a special gown when they graduate.6. There are several __________ (attract) parks in the middle of the city.7. There is one important __________ (differ) between Canada and the U.S.8. __________ (extreme) temperatures made the trip dangerous.9. The math class is a __________ (require) for this major.10. The writer's argument was very __________ (convince). Persian Empire, Egypt and the Indus Valley were conquered by whom? What two reasons did the spanish have for deciding not to focus on their northern borderlands? what is the number of atoms in 7.25 moles of potassium? Which is an example of a prokaryotic cell?E.coli bacteria cellTree leaf cellHuman skin cellYeast fungal cell FOR 50 POINTS ----- list examples of study tools (besides flashcards or online study tools) im really just too lazy to think so if someone could think for me that would be great Solve the following for x:4x + y = za.x = z - y - 4b.x = z/4c.x = z-y/4d.x = z+y/4Explain changes in flexibility with aging are primarily associated with write the equation (y=kx) find the output (y) of the function y = - 4/15 x + 24 if the input is 120. x = ________ Hi! looking for quick help here thank you. ill give brainliest if able to. Find the measure of the indicated angle. Research a manufacturing companys website and develop a set of five recommendations to help to attract potential clients and future employees to the organization.Ex: Coke, Sprite, Jelly Belly How did the Declaration of Independence end?A. with a list of grievances against King George III B. with an overview of colonial beliefs C. with a solemn pledge by Congress to uphold the ideas statedD. with a definition of independence If g(3) = 5 and g(-1) = 5, explain why g(x) does not have an inverse. thermal energy is the _____ of the kinetic and potential energies of all particles in an object. what do most organisms contain? Which statement best explains whether JKL is congruent to MNP? Which foods and exercises can best help a person prevent osteoporosis? Steam Workshop Downloader