What is the animal organelle name
order 1-15.

Answers

Answer 1

Answer:

I dunno

Explanation:


Related Questions

Location X is next to Location Y and they are both much colder than Location Z. Which statement is most likely true? a Locations X and Z are at the poles. b Locations X and Y are at the poles. c Locations X and Z are at the equator. d Locations X and Y are at the equator. WILL MARK BRAINLIEST

Answers

B locations X and Y are at the poles

Why are cells so small?

Answers

Answer:

Why are cells small? because they can absorb nutrients much more efficiently. Because they are smaller they can efficiently absorb enough food. When a cell doubles in size the volume increases much more then the surface area, which is why large cells cannot receive enough food efficiently for their volume.

Hope this helped :)

Question 2
In this part of the experiment, you’ll prepare and test three milk solutions: milk and water, milk and lactase enzyme, and milk and heated lactase enzyme.

Prepare

Use masking tape to label the three beakers: “milk,” “lactase solution,” and “heated lactase solution.”
Measure 60 milliliters of milk in the graduated cylinder (or ¼ cup of in a measuring cup. Pour it into the beaker labeled “milk.”
In the beaker labeled “lactase solution,” add one lactase tablet and 100 milliliters (or 1/2 cup) of cool or room-temperature water. Use the stirrer to dissolve the lactase tablet in the water.
Add 100 milliliters (or 1/2 cup) of milk to the microwaveable container. Dissolve a lactase pill in the container. Put the solution in the microwave and heat it to boiling (about 2 minutes). Use oven mitts to remove the container. Pour the heated lactase solution into the beaker labeled “heated lactase solution” and let it cool.
Stay safe! Be careful while handling the boiled mixture to avoid spilling it on your hands.

Test

While you’re waiting for the lactase solution to cool, read the directions on the test strips. The test strips in the Edmentum lab kit will react to glucose within a few seconds. If you use different strips, the reaction time may vary. Now follow these steps to test the solutions. Record your data in the answer space.

Milk and water solution: Fill the first test tube one fourth full of milk. Fill the small graduated cylinder with water and gently add it to the milk in the test tube until the test tube is half full. Use the stirrer to thoroughly mix the solution. Then insert the test strip for 10 to 20 seconds. Look at the test strip, and record whether it changed color. Wash the stirrer.
Milk and lactase enzyme solution: Fill the second test tube one fourth with milk and one fourth with the lactase solution. Use the stirrer to thoroughly mix the solution. Insert the test strip for 10 to 20 seconds, and record whether it changed color. Wash the stirrer.
Milk and heated lactase enzyme solution: Fill the third test tube with one fourth milk and one fourth of the heated lactase solution. Use the stirrer to mix the solution. Insert the test strip for 10 to 20 seconds, and record whether it changed color.
Note: Keep the lactase and heated lactase solutions for the next part of the experiment.

Wash the “milk” beaker, the test tubes, and the stirrer. If you used paper cups as an alternative, throw them away.

Answers

Answer:

The bacterium should stop production of lactase.

Explanation:

This is because the E. coli bacteria can degrade lactose, but lactose is not preferred as source of fuel or energy to glucose. If glucose is present, E. coli would preferably employ it over lactose as Glucose needs little process and minimal energy to degrade when compared to lactose. Although, if lactose is the major sugar that is present, the E. coli will have no option than to employ it as it's source of fuel or energy. The formation of lactase enzyme utilizes energy, which cannot be utilised in the presence of high level glucose.

This appears to be a set of instructions for a lab experiment involving testing different milk solutions with lactase enzyme.

What is lactase enzyme?

Lactase is an enzyme that breaks down lactose, a sugar found in milk and dairy products, into glucose and galactose. People who are lactose intolerant have insufficient levels of lactase, which can lead to symptoms such as bloating, gas, and diarrhea when they consume dairy products.

The experiment involves preparing three different solutions (milk and water, milk and lactase enzyme, and milk and heated lactase enzyme) and then testing each solution with a test strip to see if it changes color, indicating the presence of glucose.

The instructions also include safety precautions, such as being careful while handling the heated lactase solution. Finally, the instructions remind the reader to wash all equipment used in the experiment.

Some people may have lactose intolerance, which means that they do not produce enough lactase to break down lactose in their bodies, resulting in discomfort and digestive problems.

Learn more about Lactase at:

https://brainly.com/question/27612608

#SPJ3

What is the carrying capacity (approx)?

Answers

Answer:

ecological terms, carrying capacity is defined as the maximum number of a species that can sustainably live in a given area.

Drop a paper, a piece of thermopol, and a piece of plastic from a height of 10-15 feet. Note the time for each object to hit the ground. Why does the paper take more time than thermopol and thermopol more than the plastic piece? Make the paper to fell down in such a way that it should hit the ground before all of them. How did it happen? Explain.

Answers

It took the paper longer because is has a lot of surface area that air can resist to and push up, making it float slowly to the floor rather then drop quickly. The piece of plastic is also more aerodynamic than the piece of paper because the air wont have as much surface area to resist to.

We folded it into a paper airplane. We did this so that it will be more aerodynamic.

Correct me if I’m wrong.



It took the paper longer as it has quite a few surface places that air can withstand and push up, making it glide slowly to the ground rather than drop fast. The piece of plastic is likewise extra aerodynamic than the piece of paper because the air won't have as an awful lot of floor regions to face up to.

What is aerodynamic in simple terms?

Aerodynamics is the way air actions around matters. The guidelines of aerodynamics give an explanation for how an aircraft is capable of fly. whatever that movements through air reacts to aerodynamics. A rocket blasting off the launch pad and a kite within the sky react to aerodynamics. Aerodynamics even acts on vehicles, considering that air flows around motors.

What is an aerodynamic example?

Aerodynamics is the way air moves around matters. given that air is all around us, there are many examples of aerodynamic technology other than for aircraft. take a look at golf balls for instance. golfing balls have their unique shape with loads of dimples on them to improve their aerodynamics and create more lift.

Learn more about Aerodynamics at https://brainly.com/question/4702501

#SPJ2

What is the function of epithelial cells?

Answers

Answer:

Pretty much everything that goes on inside ur body

Explanation:

Epithelial tissues are widespread throughout the body. They form the covering of all body surfaces, line body cavities and hollow organs, and are the major tissue in glands. They perform a variety of functions that include protection, secretion, absorption, excretion, filtration, diffusion, and sensory reception.

what properties of carbon explain carban's ability to form different large and complex structure?​

Answers

Sick icijdnxn I. N I I j. Snap

What are some common characteristics that infectious agents like viruses, bacteria, fungi and parasites have in common? What are some differences?

Answers

Bacteria. These one-cell organisms are responsible for illnesses such as strep throat, urinary tract infections and tuberculosis. Viruses. Even smaller than bacteria, viruses cause a multitude of diseases ranging from the common cold to AIDS. (Here is some that I found.)

Which fish species are the least tolerant of water pollution? Which fish species are most tolerant. how would you arrive at your conclusion?
Fishes used;
Bass
Carp
Gar
Catfish
Trout​

Answers

The fish that is less tolerant to water pollution is trout hope this helps :D

In this diagram below , which of the stomach tissues would be muscular tissues ?


- tissue 1 : forms the outer lining of the stomach


-tissue 2 : produces enzymes which are secreted into the stomach cavity


- tissue 3 : cells in this tissue contract to churn the contents of the stomach


In a numeric number

Answers

Tissue 1 which forms the outer lining of the stomach would be the muscular tissues.

What is Muscularis mucosa?

This is referred to as the outermost layer of the mucosa and comprises of elastic fibers and smooth muscle cells.

The muscular tissue is therefore tissue 1 as a result of its location and function in the body.

Read more about Muscular tissues here https://brainly.com/question/2648088

#SPJ1  

Why does oxygen from our lungs diffuse into the bloodstream?

Answers

Answer:

so we can breath duh

Explanation:

can anyone help me with this question? whoever answers first gets brainliest!

Answers

Answer:

A is the most likely

Explanation:

If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?

Answers

UACCGCUCCGCCGCUCGACAAUACC

Which phrase is appropriate for an advertisement for a health service?
"new discovery"
"FDA-approved''
"amazing results"
"European"

Answers

The answer would be amazing results

Answer:it’s FDA-approved

Explanation:

Don’t do amazing results it’s wrong I took the test

Pea plants can have alleles for being tall or for being short. A pea plant has one allele for being tall, and one allele for being short. When it grows, it ends up being a tall plant.

because of this what do we know is true about pea plant alleles?

A. being short is a dominant allele

B. All pea plants must be short

C. All pea plants must be
tall

D. Being tall as the dominant allele

Answers

Answer:

D

Explanation:

the dominant traits tends to be the one shown

What happens when an organism is eaten? A. All of its energy is returned to producers. B. All of its energy is gone when it dies and cannot be reclaimed by the ecosystem. C. A small portion of its energy is absorbed by the consumer, the rest is transformed into heat or waste. D. All of its energy is absorbed by the consumer.

Answers

Answer:

The higher organisms eat the lower organisms, break down their matter and rearrange the molecules to make their own matter. When any organism dies, the remains are broken down and put back into the cycle as inorganic molecules. Each of these organisms eat organic matter to produce energy and small pieces of matter.

Which defensive adaptation would best help a plant survive in an environment with leaf-eating animals?

A.
large fruits

B.
thick stems

C.
sharp thorns

D. colorful flowers

Answers

Answer:

C.  sharp thorns

Explanation:

The plants stand still, are not very physically active, and seem to be on the menu of many animals. Precisely because they cannot win at the first sign of danger, one has developed other ways in which they can defend themselves from annoying and dangerous animals.

Some have developed long thorns that repel attackers. Some have poisons that are very strong and because of which animals do not think of trying to eat that plant, but the defense of some plants seems to be well thought out and ready for all forms of attack.

PLEASE HELP ME NOW!!!!!!!!!!!
(02.03 HC)
Examine the layers of rock. Identify and explain which layer contains the youngest fossils. (3 points)

Answers

Answer:

A

Explanation: A is the youngest bestie <3333

Answer:

A

Explanation:

Because it is at the top

Hibernation is an example  of A physical or structural adaptation .
True or false

Answers

False , only camouflage is a physical adaptation

Answer:

yea false

Explanation:

I NEED HELP ASAP!!!! BRAINLIEST AND 50 POINTS!!!! Cycles in nature involve the recycling of matter. Which of the following processes is a key part of the water (hydrological) cycle? a
transpiration
b
combustion
c
photosynthesis
d
decomposition

Answers

Cycles in nature involve the recycling of matter the following processes is a key part of the water (hydrological) cycle the photosynthesis.

What is the importance of water cycle?

The water cycle is a critical ecological procedure that continues the share of water in the earth's ecosystem and ecosystems. The water cycle entails the cyclic motion of water from water our bodies and groundwater into the ecosystem via plants, which play a position in this cycle through photosynthesis and transpiration.

Photosynthesis in concerned withinside the water cycle as it helps transpiration and makes use of water as a reactant.

Read more about the hydrological:

https://brainly.com/question/5187046

#SPJ1

when a chicken with black feathers mates with a chicken with white feathers, their offspring may be a speckled hen. Half of a speckled hen's feathers are black and the other half are white. This is an example of:

A. multiple alleles

B. simple dominance

C. Codominance

D. incomplete dominance

Answers

i’m pretty sure it’s C. Codominance

Answer:

codominance

Explanation:

2. A unique characteristic of the banyan tree is that roots grow down from its
branches into the ground. The tree can appear to have several trunks. What
advantage does this root characteristic give the banyan tree over other trees?
A. The roots provide shelter for ground-dwelling animals, which carry nutrients
to the tree.
B. The banyan can grow near the equator, because aboveground roots are
more protected from the sun.
C. The banyan can only grow in humid climates, because aboveground roots
are more likely to dry out and die during droughts.
D. The banyan can grow in areas prone to hurricanes and typhoons because
the roots make the tree more stable in high winds.

Answers

Answer:

D. The banyan can grow in areas prone to hurricanes and typhoons because

the roots make the tree more stable in high winds.

Explanation:

According to this question, banyan tree posseses a unique characteristic in which roots grow down from its branches into the ground making the tree appear to have several trunks. This type of root is called STILT OR PROP roots.

The major function of this stilt roots is to provide additional support for the plant during adverse conditions. Hence, a major advantage that this root characteristic give the banyan tree over other trees is that it confers resilience upon the banyan tree, making it able to grow in areas prone to hurricanes and typhoons because the roots make the tree more stable in high winds.

What are 2 things to all cells have?

Answers

Answer:

All cells have CYTOPLASM and DNA.

Explanation:

my answer got deleted.

Who coined the word 'antibiotic'?

Answers

Answer:

Selman Waksman, the microbiologist who discovered streptomycin, first used the word "antibiotic" in the medical sense in 1943. Science historian Howard Markel talks about how it was actually a naval officer who first coined "antibiotic" in 1860, to describe an opposition to the belief in life beyond Earth.

What roles do humans play in the carbon cycle?

Answers

Answer:

Humans affect the carbon cycle by burning fossil fuels and cutting down trees. Car exhausts and factory emissions produce a lot more CO2 in the atmosphere!

Explanation:

HOPE THIS HELPS:)

Will give brainliest to whoever gets it right at the end of my exam :))

Answers

Answer:

#3

Explanation:

Elevated fibrinogen levels result in a(n) ___________, which increases the risk of a coronary or cerbrovascular incident.

Answers

Answer:

hypercoagulable state

Explanation:

Elevated fibrinogen levels result in hypercoagulable state , which increases the risk of a coronary or cerbrovascular incident.

A hypercoagulable state in medicine refers to a condition in which there is an abnormal increase in the tendency toward the clotting of blood also known as blood coagulation.

When fibrinogen levels are high, there is an increase in clot stiffness, increase in resistance of the clot to fibrinolysis as well as an increased blood viscosity.

Which pair of objects has the largest gravitational force?
a- car and bowling ball
b- marble and baseball
c- There is no gravitational force between any of these pairs of objects.
d-marble and can

Answers

Answer:a

Explanation: they are bigger they take up more space and heavier so the pull of gravity is stronger because of that

Atoms in covalent bonds _____ their electrons.

Answers

um i think it’s share but i’m not sure

Answer:

share

Explanation:

covalent bonds share electrons

ionic bonds transfer electrons

NEED HELP VERY SIMPLE WILL MARK BRAINLIEST THANKS

Answers

Answer:

The organism

Explanation:

Answer:

last one and the second

Explanation:

Other Questions
Patrick makes chocolate chip cookies. The recipe calls for 1 3/4 cups of flour. If Patrick triples the recipe, how much flour will he need? WHAT IS THE NET FORCE (CENTRIPETAL FORCE) FOR A 1500 KGCAR DRIVING 5 M/S AROUND A CURVE, 10 M IN RADIUS? Which event occurred on November 11, 1918? A)The first American troops arrived in Europe. B)The battle of Meuse-Argonne started. C)The Allies accepted the Fourteen Points. D)The armistice ending the war was signed. Mika taught her sister the steps for diviting a decimal by a decimal which instructions are correct the valency of oxygen is 2 I think of a number,i added 4 to the number, the result is 20 12. The number of mold spores in the school bathroom sink started at 4. The number of spores doubled every day. The equation f(x)=42^x models the situation. How many mold spores willthere be after 6 days?spores What is the equation of the line that passes through the points (-3, -2) and (1, 6)? CAN SOMEONE PLEASE ANSWER MY MOST RECENT QUESTION I REALLY NEED IT DONE!!!!!Analyze the map below and answer the question that follows.Identify the five climates numbered on the map. 10x- (- 4 + 7xanswer if you can :) Tim knows that he can travel a distance of 240 miles when his cars gas tank is filled to its capacity. The capacity of his cars gas tank is 12 gallons. Which best describes the domain of the function? only integers where 0 d 12 only integers where 0 , d , 12 only integers where 0 d 240 only integers where 0 , d , 240 all real numbers where 0 d 12 all real numbers where 0 , d , 12 all real numbers where 0 d 240 please help .this is very importantIn the middle of the night, you are awakened by hunger pains. You proceed to get up and go to the kitchen to have a couple of cookies and a glass of milk. Satisfied you go back to bed content. Explain in detail what tissues, organs, and organ systems are involved in completing that task. Be sure to include how the systems interact. The more detail the better! Start with getting up to get the food and include details on the steps in how the food gets digested. Explain in detail The weight of an object on Mars varies directly with its weight on Earth.An object that weighs 50 pounds on mars weighs 150 on Earth.If an object weighs 120 pounds on Earths,write and solve a direct variation equation to find how much an object would weigh on mars. Which of these is the strongest example of multilateral foreign policy?One nation states publicly that it will refuse to trade with any nation that criticizes its leader.One nation refuses to trade with a rival nation because it does not allow women to vote in an upcoming election.Two rival nations go to war with one another over disputed territory.Two allied nations enforce economic sanctions on a country until its government changes a key policy. what can we understand about Prithvi Narayan shah as a person from the fact that he respected common people's view like bise Nagarchi and others PLS HELP: I am unsure how to calculate this into final numbers.Cal Amity found that 24% of his sample answered "yes" to the third survey question, which was, "Have you done anything, or will you do anything, to prepare any other part of your home before Gourmando's visit?" (880 Surveyed)Mr. Amity can infer that, most likely, between _[blank A]_ and _[blank B]_ inhabitants of the Kingdom have done, or will do something, to prepare another part of their homes before Gourmando's visit. The distance from Matts home to school is 5/8 of a mile. He has biked 3/8 of a mile. How much further does he have to bike? Solve: 5/2x - 1/3= -1/2A. x=-5/12B. x= -25/12C. x= -1/15D. x= 1/3 Which choice shows an opinion that is best supported with evidence?A) Anyone who is interested in history will like James Cross Giblins The Riddle of the Rosetta Stone because Giblin gives a lot of information about ancient Greek and Egyptian history.B) Champollion translated many of the cartouches in ancient Egyptian tombs and concluded that they represented titles of monarchs, such as "Caesar," "Great King," and "Beloved of the Gods." C) Champollion is clearly the hero of James Cross Giblins The Riddle of the Rosetta Stone because most of the story seems to be about him and his work deciphering the Rosetta Stone.D) James Cross Giblins word choice shows that he respects Champollion because he states that Champollion was proven to be correct without any doubt and he describes Champollions book as ground-breaking. 3/4 c - 7/12 + 7/24 c + 2/3 - 1/6 c Steam Workshop Downloader