What characteristic of water helps in regulating cell temperature and maintaining homeostasis?

Someone please help i need a claim, evidence, then a reasoning !

Answers

Answer 1

Answer:

The characteristic of water that helps regulate the temperature of the cells and maintain homeostasis is specific heat (Claim).

Explanation:

Specific heat is a physical property that is defined as the amount of heat needed to raise one gram of a substance by one degree Celsius. In the case of water, its specific heat is higher than that of other substances, being its value 4.186 joules/gram °C, or also 1 calorie/gram °C.

- Claim: The property of water that allows cells to regulate temperature and maintain homeostasis is specific heat.

- Evidence: a high specific heat value of water means that in bodies that possess this molecule in large quantities it is more difficult to raise the temperature

- Reasoning: Living beings are formed mostly by a high percentage of water, much of it in the intracellular compartment. The specific high heat of the water makes it difficult to have sudden changes in the internal temperature, even when the environmental temperature is high, which is a property of water that allows thermoregulation and maintains the balance or homeostasis.


Related Questions

1. Even though the atom is made of charged particles, it is still neutral Explain why. (1 point)

Answers

Answer:

An atom is electrically neutral (overall charge is zero) since the total number of protons is equal to the total number of electrons.

Hope this answered your question :)

Sulfur has 16 electrons in its atoms. Over how many energy levels are the electrons distributed, and how many are in each
energy level?

Answers

Sulfur has 16 electrons in its atoms. Over how many energy levels are the electrons distributed, and how many are in each energy level? The electrons in a sulfur atom are distributed over the three energy levels; there are two electrons in the first energy level, eight in the 2nd, and six in the third.

I NEED HELP

1. What are chromosomes?
2. What are the four phases of mitosis, in the correct order?
3. In what phase of mitosis are chromosomes moving toward opposite sides
of the cell?
4. Compare the two nuclei that form as a result of mitosis?
5. What is cytokinesis, and when does it occur?

Answers

Answer:

1. a chromosome is a dna strand that has genes

2. prophase, metaphase, anaphase, telophase

3. anaphase

4. the two nuclei are identical daughter cells and they have the same number of chromosomes

5. this is when the cell separates forming two new daughter cells and it occurs in the late telophase of mitosis.

sorry if this is wrong but this is how i learned it! hope it helps!

Explanation:

In non-mendelian genetics, humans have 4 blood types in which A and B are codominant and o is recessive. I cross two parents with type AB blood. What is the percentage of children with type B blood?

A. 0%
B. 25%
C. 50%
D. 100%

Answers

Answer:

i think it may be 50 dont be mad if im wrong

Explanation:

recessive takes over from what i read i dont see any o so it can be half a half b so 50...

What is the nervous system and how does it help you function? What structures are included in the human nervous system?

Answers

The nervous system is the major controlling, regulatory, and communicating system in the bodyThe nervous system plays a role in nearly every aspect of our health and well-being. It guides everyday activities such as waking up; automatic activities such as breathing; and complex processes such as thinking, reading, remembering, and feeling emotionsThe nervous system has two main parts: The central nervous system is made up of the brain and spinal cord. The peripheral nervous system is made up of nerves that branch off from the spinal cord and extend to all parts of the body.

Bones provide attachments that allow skeletal muscles to cause movements? True or false

Answers

Answer:

True ...........................

Which of the following is NOT produced by
respiration
sugar
Ds ATP energy
carbon dioxide
water

Answers

Answer:

I think its water or sugar.

Does eukaryotic cells need more lipids than prokaryotic cells

Answers

Answer: yes because they need more energy

Explanation:eukaryotes are more complex than prokaryotes

this is a cell not a plant, because the cell do not contain________

Answers

Answer:

Chloroplast.

Explanation:

This is what I believe it is since we're obviously talking about an animal cell and NOT a plant cell like it says. Animal cells do not contain chloroplast.

If this is the answer you're not looking for, let me know! Hope this helped! :)))

I will mark brainest if you get it right
A photovoltaic cell captures ____ to be used for power.
A. Wind
B. Water
C. Coal
D. Sunlight

Answers

Answer:

D. Sunlight

Explanation:

Answer:

santa claus

Explanation:

In the water cycle, water returns to the ground as precipitation. How does phosphorus return to the soil in the phosphorus cycle?
A.
Phosphates found in soil dissolves in water.

B.
Phosphates are absorbed by the roots of plants.

C.
Animals eat the plants that absorbed the phosphates.

D.
Animals that ate the plants die and decompose.

Answers

Answer:

D

Explanation:

When writing experimental results, be sure to ALWAYS
A)
include the equipment used
B)
include any mistakes you made
include appropriate units on any mathematical results
D
include the names of the people who performed the lab experiment

Answers

Answer:

All of the above

Explanation:

Should include any equipment that you would need to use. Since it is an experiment you should include any mistakes you made during the experiment.

Many new reproductive strategies developed during the evolution of terrestrial vertebrates. Which statement identifies one of these new strategies? A. Eggs develop without fertilization B. Eggs develop outside of a parent's body C. Eggs are laid by the female parent only D. Fertilized eggs develop away from the body of water

Answers

Answer:

D

Explanation:

One of the reproductive strategies of terrestrial vertebrates is the ability of fertilized eggs to develop away from the body of water.

Water is very important for fertilization in aquatic organisms and one of the biggest challenges posed by migrating to the terrestrial environment is desiccation of the eggs. Terrestrial vertebrates are able to overcome these challenges by making fertilization of eggs internal and the ability of the fertilized eggs to develop away from the body of water.

The correct option is D.

Answer:

D. Fertilized eggs develop away from a body of water

Explanation:

Replication, Transcription, and Translation Chart

Please answer


DNA Replication:

1。Template Strand: Start with this nucleotide chain.

TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC



2。Complementary DNA Strand: Write directly below template strand.


Transcription:

3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).



Translation:

4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).



5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).



6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).

Answers

Answer:

jnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Explanation:

when using a solar powered calculator what source of energy is being used to power the calculater

Answers

Answer:

UV rays

Explanation:

Solar energy and solar rays is what powers the calculator

what are the two main organs involved in the respiratory system?​

Answers

Answer: The respiratory system is the network of organs and tissues that help you breathe. It includes your airways, lungs, and blood vessels. The muscles that power your lungs are also part of the respiratory system.

Explanation: Your respiratory system is the network of organs and tissues that help you breathe. This system helps your body absorb oxygen from the air so your organs can work. It also cleans waste gases, such as carbon dioxide, from your blood. Common problems include allergies, diseases or infections.

What is the respiratory system?

The respiratory system is the network of organs and tissues that help you breathe. It includes your airways, lungs, and blood vessels. The muscles that power your lungs are also part of the respiratory system. These parts work together to move oxygen throughout the body and clean out waste gases like carbon dioxide.

nose and lungs i think


Please help me with this and answer correctly.
Brainliest will give!! ​

Answers

Answer:

Sorry can't help

Explanation:

PLEASE GIVE ME BRAINLIEST

As you observe an unknown cell under a microscope, you make the following observations..

Answers

it is probably a plant cell because it has a cell wall and chloroplasts.

Answer:

It is a plant cell that is being observed

Explanation:

With in the cell, there are chloroplasts that ONLY a plant cell has. It also has a cell wall which an animal cell does not, so it is clearly not an animal cell.

Adaptations of plants in different climatic conditions in Telangana

Answers

Explanation:

Note, Telangana is known to be an area whose climate is usually semi-arid, that is, it is an area that is dry and receives some small amount of rain.

Thus, plants in the Telangana region would usually possess  the following adaptive features;

ability to survive under extreme heatgrowing longer roots than normal in other to find water in the soilefficient water conservation especially in their stems.

At the beginning of the film, director Ron Howard shows two contrasting scenes: The deaths of the Apollo 1 crew and a party celebrating the landing of Apollo 11 on the moon. How do these scenes foreshadow the rest of the movie?

Answers

Answer:

It foreshadows that the Apollo 11 made it to the moon, while Apollo 1 did not

Explanation:

please help me Which example is a trace fossil?

dinosaur footprint


dinosaur bone


dinosaur egg


shark tooth

Answers

Dinosaur egg would be your answer.

Answer:

Dinasour footprint

Explanation:

6 grade science

Choose all the answers that apply.
Binary fission _____.
is the type of reproduction used by bacteria
occurs in organisms that do not have a membrane bound nucleus
is a type of sexual reproduction creates identical copies of the parent cell
is a type of asexual reproduction

Answers

Answer:

A, B, D

Explanation:

Binary fission occurs primarily in prokaryotes, but can occur in eukaryotes. It is used by bacteria and is asexual reproductio, not sexual.

Explanation:

occurs in organisms that do not have a membrane bound nucleus. Explanation: Binary fission is an asexual mode of reproduction. As it does not involve formation and fusion of gametes.

the process of which cells make proteins is called protein what?

this is a fill in the blank!

Answers

Answer:

protein biosynthesis

Explanation:

prove me wrong

Answer:

any of a class of nitrogenous organic compounds that consist of large molecules composed of one or more long chains of amino acids and are an essential part of all living organisms, especially as structural components of body tissues such as muscle, hair, collagen, etc.

Explanation:

What is the value of the expression 3 divided by 3/4

Answers

Answer:

4

Explanation:

If we have the expression, 3/3/4.

Then this is the same as 3 × 4/3

Which is the same as 12/3

Which is the same as 4

Hence the value of the expression 3/3/4 is 4

The spinal cord relays messages between the body and the brain. These messages control body functions like movement, bladder and bowel control and breathing. Each vertebra has a pair of spinal nerves that receive messages from the body (sensory impulses) and send messages to the body (motor impulses). The spinal nerves are numbered 1 to 55 from the neck down. The first eight as seen here are the vertebrate and send messages to the back of the head, neck, shoulders, arms, hands and diaphragm. A) cervical B) lumbar C) sacral D) thoracic​

Answers

The Correct answer is C

What is a niche, and how does it relate to evolution?

Answers

Answer:

The evolution of species’ niches is a process that is fundamental to investigations in numerous fields of biology, including speciation, community assembly, and long-term regional and global diversification processes. It forms the nexus between ecological and evolutionary questions. Topics as diverse as ecological speciation, niche conservatism, species coexistence, and historical biogeography all rely on interpreting patterns and drivers of species’ niches through time and across landscapes. Despite this importance, a distinct research agenda concerning niche evolution as a discrete topic of inquiry has yet to emerge. Niche evolution is often considered as a sidebar or of secondary importance when addressing questions such as “how did two species diverge?” Basic questions such as “what is a niche,” “what is the biological basis of niche evolution,” “at what scale should we evaluate niche evolution,” and “how can we observe niche evolution at different timescales” have rarely been addressed directly, or not at all in some systems. However, various intellectual threads connecting these ideas are evident in a number of recent and historical publications, giving some semblance of form to a framework for interpreting and evaluating niche evolution, and outlining major areas for future research from an evolutionary perspective. There is a reverse perspective from the macroecological scale as well, with questions involving coexistence, distributions and ranges, food webs, and other organismal attributes

Explanation:

ye

Why is sickle cell anemia so harmful to its carriers?

Answers

Answer: BECAUSE IT MAKES THE RED BLOOD CELLS SHRINK

Explanation:

Answer:

Sickle cell anemia is harmful to the body because it is enagering your spleen and with less healthy red blood cells circulating in the body, you can become chronically anemic.

Sickle cell anemia puts your body at more risk for infection.

Explanation:

plzzz help i willl give you a Brainliest if you get it correct

Most scientists come up with questions to investigate out of the blue.

1.true

2. false

Answers

The answer is False

Answer:

the correct answer is false.

Peppered moths have learned to stay still (not move) on a tree trunk during daylight hours to avoid being eaten by birds. This is an example of...
A. Natural selection
B. Behavior adaptation
C. Structural adaptation
D. Selective breedeinh

Answers

Answer:

Behavior adaptation

Explanation:

Behavior adaptation is where a animal behaves in a different manner that suits its environment or keeps the animal safe

One danger of excessive nitrogen levels in water is BLANK.

Answers

Answer:

light

Explanation:

excessive nitrogen can harm water bodies excessive nitrogen can cause overstimulation of growth of aquatic plants and algae excessive growth of the organisms intern can clogged water intakes used to solve oxygen as they decompose and block light to deeper waters

Other Questions
Hi I need help. Also, thanks for helping me on a weekend ;u; 4. How long did the Hebrews wonder in the wilderness with Moses?80 years40 years5 years20 years Someone help me please ill give brainly Combine Like terms Jack usually mows his lawn in 3 hours. Marilyn can mow the same yard in 6 hours. How much time would it take for them to mow the lawn together? A man has a garden measuring 40m by 24m. He wants to divide it equally into the minimum number of square plots how many times does 8 go into 70 ANSWER NOW TO GET BRAINLEST IF I WERE YOU I WOULD BE BE ANSWER THIS RN AND HAS TO BE CORRECT ANSWER One teaspoon equals 0.5 centiliters. How many liters equal 50 teaspoons? Round the answer to the nearest hundredth. 0.25 liters 0.50 liters 25 liters 50 liters How are artificial selection and natural selection different? Select the best answer from the choices below. aIn artificial selection, animals that are more likely to survive reproduce bIn artificial selection, members of a species must compete to survive cIn natural selection, people impact which traits are passed on dIn artificial selection, humans choose which organisms reproduce can you please help meee? Evaluate h(x)=-2x+9 when x=-2,0 and 5 Which of the following brands of hat should she buy ? HELP ME PLEASEEEEEEE Will mark brainlist! which one is better "the reign of scar", or "Scar's Reign" Write the equation that represents the line shown Consider the following equilibrium: 2SO^2(g) + O2(9) = 2 SO3^(g)1. What is equal at equilibrium?2. What would happen to the forward rate if some 0were removed from this equilibrium?3. Explain why, in terms of collision theory.4. Would the reaction still be at equilibrium at this point? The sum of two number is 15 and thir is 1 difference 2. What mass of sulphuric acid (density 1.84 g/cm) can be held in a 250 ml bottle? .Is the following proportion true? How do you know? 4/5 = 25/40 Steam Workshop Downloader