Read the scenario, then answer the questions. A 2 kg ball is thrown upward with a velocity of 15 m/s. What is the kinetic energy of the ball as it is being thrown? J

Answers

Answer 1

Answer:

225 J

Explanation:

The kinetic energy of an object can be found by using the formula

[tex]k = \frac{1}{2} m {v}^{2} \\ [/tex]

m is the mass

v is the velocity

From the question we have

[tex]k = \frac{1}{2} \times 2 \times {15}^{2} \\ = 1 \times 225 \\ = 225 \: \: \: \: \: \: \: \: [/tex]

We have the final answer as

225 J

Hope this helps you

Answer 2

Answer:

225 J for both answers

Explanation: :)


Related Questions

plzz help this is timed! true or false/Continental air masses are cold. Maritime air masses are hot.

Answers

Answer:

False.

Explanation:

Discuss in detail the role of various scientists in the discovery of electrons, protons and neutrons

Answers

Answer: The atom has three components the electrons, neutrons and protons.

Explanation:

J.J Thomson is responsible for the discovery of electron. He discovered the electrons while determining the properties of cathode rays in 1897. Rutherford is responsible for the discovery of proton during 1909 while performing the gold foil experiment. W. Bothe and H. Becker is credited to the discovery of neutrons.                          

Draw the structure of 2-bromo, 3-chloro-4,4-dimethyl

Answers

Answer:

The compound you are asking for is not complete. But I will give you the answer to one of the compounds.

The complete compound is:

2-bromo, 3-chloro-4,4-dimethylpentane.

Attached is the structure of the compound.

Explanation:

2-bromo, 3-chloro-4,4-dimethylpentane is an organic compound. It's molecular formula is C₇H₁₄BrCl.

This compound has bromine and chlorine attached to the backbone carbon of the pentane compound. The bromine and chlorine are attached to the second and third backbone carbon of the compound respectively.

Also, the dimethyl means that the compound has two methyl (CH₃) attached to the same carbon which is the number 4 backbone carbon.

A circuit is a path along which electric current flows. How would changing the battery in a circuit from 9 volts to 1.5 volts most likely affect the circuit? More electric charge would flow in the circuit. Less electric charge would flow in the circuit. The resistance in the circuit would decrease. The resistance in the circuit would increase.

Answers

Answer:

A wave passes from a solid to a liquid while remaining the same temperature.

The medium increases in temperature while remaining in the same phase.

The medium decreases in temperature while remaining in the same phase.

A wave passes from a liquid to a gas while remaining the same temperature.

AND less electric charge would flow in the circuit

The voltage is decreased

Explanation:

PLEZZ MARK ME AS BRAINLYEST PLEZZ!!

Changing the battery in a circuit from 9 volts to 1.5 volts would most likely result in less electric charge flowing in the circuit.

What is Ohm's law ?

According ohms law, the electric voltage is the product of current and resistance in the circuit. A lower voltage battery will have less electric potential energy available to move the charges, resulting in a lower electric current flow in the circuit.

The resistance in the circuit would not necessarily increase or decrease due to the change in the battery voltage. Resistance is a property of the components in the circuit, such as resistors, wires, and other devices that can impede the flow of current.

However, if the resistance of the circuit remains the same and the battery voltage decreases, the resulting electric current flow would also decrease according to Ohm's law (I = V/R), where I is the current, V is the voltage, and R is the resistance.

Find more on circuits:

https://brainly.com/question/27206933

#SPJ7

J.J. Thompson in 1987, announced that cathode rays consisted of a stream
of ?
Hydrogen
Nuclei
Isotopes
Electrons

Answers

He announced that cathode rays consisted of a steam of Electrons.

If the absolute temperature of the gas in a balloon is halved, by how much will its volume change?

Answers

Answer:

Volume also reduced to half

Explanation:

Volume and absolute temperature are directly proportional to each others

what is observed when an iron bar is dipped into a solution of silver nitrate​

Answers

Answer:

I think it will start to have a greenish color and get lighter

Explanation:

When iso-propanol burns in oxygen, carbon dioxide and water are produced

Answers

Explanation:

When liquid isopropanol (C3H8O) burns in oxygen gas, carbon dioxide gas and liquid water are produced. When dissolved sodium hydroxide reacts with sulfuric acid, aqueous sodium sulfate and water are formed.

How many molecules are in 13.2 g NO2?

Answers

Answer:

No. of molecules= mass/molar mass ×avogadro no.

                         =  13.2/50×6.02×10°23

  No. of molecules =1.59×10°23

Explanation:

Can someone answer these two separate questions pls ill give brainliest

Answers

The average speed

3. 89.7 m/min

4. 6.13 ft/min

Further explanation

Given

3. 1076 m in 12 min

4. 92 ft in 15 min

Required

average speed

Solution

3.

I am solving for : the average speed

The equation I need is :

[tex]\tt avg~speed=\dfrac{total~distance}{total~time}[/tex]

This is how I set the equation

[tex]\tt avg~speed=\dfrac{1076~m}{12~min}[/tex]

This is my answer = 89.7 m/min

4.

I am solving for : the average speed

The equation I need is :

[tex]\tt avg~speed=\dfrac{total~distance}{total~time}[/tex]

This is how I set the equation

[tex]\tt avg~speed=\dfrac{92~ft}{15~min}[/tex]

This is my answer = 6.13 ft/min


Na2SO3 + S -------> Na2S2O3


Answers

Answer:

Synthesis

Explanation:

A+B=C

Question 5 please thanks! Due in 4 Minutes xoxo!.

Answers

the answer would be B

the particles wouldnt break, nor would the form new particles or just disappear

Replication, Transcription, and Translation Chart
Please answer


DNA Replication:

1。Template Strand: Start with this nucleotide chain.

TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC



2。Complementary DNA Strand: Write directly below template strand.


Transcription:

3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).



Translation:

4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).



5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).



6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).

Answers

I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.

Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC

Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG

mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG

Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG

(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop

i need help asap. which are the products?

Answers

Answer:

A

Explanation:

The products of a chemical equation is what is being experimented with. However, the results in which you get are known as your solution.

what is the purpose of chemistry?

Answers

Answer:

To know more about chemicals and how to utilise them to solve man's probl

2. What is the smallest unit of an organism that is classified as living? *
10 points
A. an atom
B. a molecule
C. an organ
D. a cell

Answers

Answer:

D

Explanation:

The cell is the basic structural, functional and biological unit of all known living organisms. Cells are the smallest unit of life that is classified as a living thing, and are often called the "building blocks of life.

Answer:

a cell

Explanation:

All living things are made of cells; the cell itself is the smallest fundamental unit of structure and function in living organisms.

In the lab you react 23 g of potassium iodide with an excess of lead (II) nitrate to form 18 g of lead (II) iodide precipitate. What is the percent yield of your experiment?

A) 28
B) 56
C) 84
D) 98

Answers

Answer:

B) Percent yield = 56%

Explanation:

Given data:

Mass of potassium iodide = 23 g

Mass of lead iodide formed = 18 g

Percent yield = ?

Solution:

Chemical equation:

2KI + Pb(NO₃)₂    →     2KNO₃ + PbI₂

Number of moles of potassium iodide:

Number of moles = mass / molar mass

Number of moles = 23 g/ 166 g/mol

Number of moles = 0.14 mol

Now we will compare the moles of PbI₂ and KI:

                      KI          :           PbI₂        

                      2           :             1

                      0.14      :          1/2×0.14 = 0.07        

Theoretical yield of PbI₂:

Mass = number of moles × molar mass

Mass = 0.07 × 461 g/mol

Mass =  32.27 g

Percent yield:

Percent yield = actual yield / theoretical yield × 100

Percent yield = 18 g/ 32.27 g × 100

Percent yield = 56%

Which of the following is composed mostly of ice?


Asteroids


Gaseous planets


Comets


Meteorites


Stars

Answers

Answer: The answer is C- comets!                                                                            

Explanation:  Callisto is composed mainly of rock and water ice, although other ices like ammonia ice and carbon dioxide ice may be present. Water ice occurs at the surface of Callisto so it would be comets.

(HELP FAST )The model shows a molecule of silk made by a spider.

Answers

An atom is each sphere which are all connected

F
19.00
Fluorine
Using the information on the figure above, report the atomic number and atomic mass of fluorine.

Answers

Answer:

From the periodic table, Atomic number of fluorine is 7 and atomic mass is 19

What do elements in a group on the periodic table have in common?

Answers

Answer:

They have similar chemical properties.

Explanation:

james madison test

The elements in a group on the periodic table have in common that they all are arranged on the basis of the number of electrons in the outer most shell of the atom.

What is periodic table?

The periodic table of  elements is defined as in which the classified all the non metals accordance with their properties in such a way that with similar properties are grouped.

Moosley arranged the elements in increasing order of their atomic number and observed that after a certain time of interval elements with same properties are repeated.

Therefore, elements in a group on the periodic table have in common that they all are arranged on the basis of the number of electrons in the outer most shell of the atom.

Learn more about periodic table, here:

https://brainly.com/question/11155928

#SPJ6

Indicate which one of the two species is larger
A. Mg2+ or Ca2+

Answers

Answer:

Ca2+ is larger than Mg2+

Explanation:

Mg2+ has total 10 electrons and Ca2+ has total 18 electrons. So, Ca2+ will have more no of subshell which means greater particle size.

What is the wavelength of a wave with energy equal to 1.528 x 10-13 J? E=hc/LaTeX: \lambdaλ Energy= Measured in Joules h=Plank's constant, 6.626 x 10-34 J x s c=speed of light, 3.00 x108 m/s LaTeX: \lambdaλ= wavelength in meters Group of answer choices 1.301 x 1029 m 6.918 x 1028m 6.918 x 10-13m 1.301 x 10-12m

Answers

Answer:

1.301 × 10⁻¹² m

Explanation:

Step 1: Given and required data

Energy of the electromagnetic wave (E): 1.528 × 10⁻¹³ JPlanck's constant (h): 6.626 × 10⁻³⁴ J . sSpeed of light (c): 3.00 × 10⁸ m/s

Step 2: Calculate the wavelength (λ) of the electromagnetic wave

We can calculate the wavelength of the electromagnetic wave using the Planck-Einstein's relation.

E = h × c / λ

λ = h × c / E

λ = (6.626 × 10⁻³⁴ J . s) × (3.00 × 10⁸ m/s) / 1.528 × 10⁻¹³ J

λ = 1.301 × 10⁻¹² m

The wavelength of this wave is equal to: D. [tex]1.301 \times 10^{-12}\;meter[/tex]

Given the following data:

Energy = [tex]1.528 \times 10^{-13} \;Joules[/tex]Plank's constant = [tex]6.626 \times 10^{-34}\;Js[/tex]Speed of light = [tex]3 \times 10^8\;m/s[/tex]

To determine the wavelength of this wave, we would apply Einstein's equation for photon energy:

Mathematically, Einstein's equation for photon energy is given by the formula:

[tex]E=\frac{hc}{\lambda}[/tex]

Where:

E is the energy. h is Plank's constant.[tex]\lambda[/tex] is the wavelength.c is the speed of light.

Making [tex]\lambda[/tex] the subject of formula, we have:

[tex]\lambda = \frac{hc}{E}[/tex]

Substituting the given parameters into the formula, we have;

[tex]\lambda = \frac{6.626 \times 10^{-34}\; \times \;3.0 \times 10^{8}}{1.528 \times 10^{-13} }\\\\\lambda = \frac{1.99 \times 10^{-25}}{1.528 \times 10^{-13} }\\\\\lambda =1.301 \times 10^{-12}\;meter[/tex]

Read more: https://brainly.com/question/9655595

What is the molecular formula of a compound that is composed of 94.1% O and 5.9% H with a molar mass of 34g

Answers

Answer:

H2O2

Explanation:

I know it's been awhile since the question was asked but for future people like me its H2O2 I got it right in the quiz.

The whole-number multiple is obtained by dividing its molar mass (34.02 g/mol) by the empirical formula mass. H₂O₂ is the molecular formula of a compound that is composed of 94.1% O and 5.9% H with a molar mass of 34g.

What is molar mass ?

The mass of a sample of a chemical compound divided by the quantity, or number of moles in the sample, measured in moles, is known as the molar mass of that compound. The molar mass of a material is a bulk attribute rather than a molecular one.

The mass of 6.022 × 10²³ atoms, molecules, or formula units of a material are equal to its molar mass, which is the mass of 1 mole of that substance represented in grams per mole.

Molar mass is a crucial factor to consider while planning an experiment. The molar mass enables you to calculate the quantity you should weigh out on your scale when testing theories that call for specified amounts of a material.

Thus, H₂O₂ is the molecular formula of a compound that is composed of 94.1% O and 5.9% H with a molar mass of 34g.

To learn more about molar mass follow the link;

https://brainly.com/question/12127540

#SPJ3

What is the mass of 5 moles of Fe2(CO3)3 ?

Answers

Answer:

1218.585

Explanation:

Looking at the subscripts we know there are 2 atoms of Fe, 3 atoms of C, and 6 of O.

Take the molar mass of each atom (from the periodic table) and multiply by the # of atoms

Fe: 55.845×2= 111.69

C: 12.011×3= 36.033

O:15.999×6=95.994

Add the values together: 243.717 g/mol

That is 1 mole of the molecule. Multiply by 5 for the final answer.

243.717×5=1218.585

Atoms of which element below are most likely to gain electrons?
Group of answer choices:

carbon

lithium

zinc

phosphorus

Answers

Answer:

Carbon and phosphorus

Explanation:

The atoms of carbon and phosphorus are most likely to gain electrons from the given choices .

The reason for this is because, both carbon and phosphorus are non-metals. Most non-metals usually accept electrons.

Metals are usually electron donors .

Metals are known for their electropositivity which is their ability to lose electrons. Non-metals are electronegative and will tend to have a strong affinity for electrons.

plzzzzzzzzzzzzz help i will mark you brainlest true orfalse/Air masses are responsible for the weather in a region

Answers

Answer:

True

Explanation:

Answer:

It is true!

I hope this helps. Have an awesome day <3

What is independent variable

Answers

An independent variable is a variable that stands alone and isn’t changed by the other variables you are trying to measure.

Answer:

An independent variable is exactly what it sounds like. It is a variable that stands alone and isn't changed by the other variables you are trying to measure.

Conduction, convection and radiation can occur in variety of ways. Give another example, like the campfire picture above, where you have seen all three methods occur.

Answers

Answer: Boiling water

Explanation:

2. Why do ions form?

Answers

Answer:

When atoms lose or gain electrons, they become positively or negatively charged ions. In an ionic compound, the ions are arranged in a three-dimensional structure called a crystal. ... When an atoms gains or loses electrons, it gains a charge, thus becoming an ion.

Explanation:

Answer:

The iron ore deposits began forming when the first organisms capable of photosynthesis began releasing oxygen into the waters.

Explanation:

Other Questions
What types of radiation cause the parent isotope to change into a different element? Find the volume in milliliters (ml) of 25gof benzene. The density of benzene is 0.8765 g/mL Round 3.3453 to 2 decimal place math solve questions Which type of nonfiction shouldbe used to convince readers toconserve water?A. persuasive essayB. autobiographyC. biography The table shows the price for different numbers of icecream treats:Number of Icecream Treats Price(in dollars)2 65 157 2112 36Does this table of numbers represent a proportional relationship? (5 points) aYes, because the price is 3 times the number of icecream treats bYes, because 3 times the price is the number of icecream treats cNo, because the price of 5 icecream treats should be $12 and not $15 dNo, because the price of 12 icecream treats should be $48 and not $36 What kinds of images would you use in a trailer for The Call of the Wild? How will you decide which images to use? Two prominent research groups came to the same surprising conclusion after taking measurements of the luminosity of Type Ia supernovae at great distances, this being that the universe is accelerating while it expands.A. TrueB. False noOOOOOoooOOoOOoOOoOO a boulder with a mass of about 1.5 x 10^5 kg falls and strikes the ground at 70 m/s how much kinetic energy dies the boulder deliver to the ground PLEASE HELP NEED HELP ASAP An indoor soccer field is a rectangle that is 700 feet long by 250 feet wide. Coach Garza is having his players run diagonally from one corner of the field to the opposite corner. What is the distance the players must run? LEO has $30. He splits it with his sister in the ratio 3:2. How much money does leo have left? What is the equation of the line passing through the points (25, 50) and (25, 50) in slope-intercept form?y = negative 50 xy = negative 50y = 50 xy = 50 How did the New Deal change the role of the federal government in theUnited States? please help!! ill give brainliest Which sentence has modifiers in the right place to make its meaning clear?A.Every year, we bought a homemade apple pie at a little store that cost only $5 on the road to the cabin.B.Every year, we bought a homemade apple pie that cost only $5 at a little store on the road to the cabin.C.Every year, we bought a homemade apple pie at a little store on the road to the cabin that cost only $5. Supply-and-Demand Schedule for Cell Phones Price of Cell PhonesQuantity Supplied of Cell PhonesQuantity Demanded of Cell Phones $25 0 500 $50 200 450 $100 300 300 $150 400 250 $200 500 0 In the supply-and-demand schedule shown above, at the prices of _____ and _____, there is excess supply because quantity supplied is greater than quantity demanded. $25, $50 $25, $200 $150, $200 Select the correct answer from each drop-down menu.Read the body paragraph of a persuasive essay about the need for teenagers to get enough sleep. Select the best supporting evidence to includein the paragraphOne reason schools should start later is that teenagers need more sleep. According to the National Science Foundation, teens shouldHowever, teenagers have a lot of pressures and activities. It can be difficult for them to quiet theirminds and get to sleep. Frederic Henry's perspective and attitude about war changes drastically in this story by Hemingway. How and why does Henry's change happen? Write a reflective essay in which you explain Henry's change in thinking about war and connect this to a personal experience where you underwent a significant change of perspective, how and why this change happened, and how this benefited your life. The essay's thesis statement and body contents should refer to A Farewell to Arms and clearly state the connection. The conclusion should refer back to A Farewell to Arms too. 6. Children's books are an example of... Steam Workshop Downloader