please help me........

Please Help Me........

Answers

Answer 1

Answer:

It's B

Hope it helps

Answer 2
It is B. It is the most reasonable answer.

Related Questions

Number 17 please help brainliest for best
And 13 pts

Answers

Answer:

the width is 7 1/9 feet or 7.1 repeating decimal

Answer:

the width is 7 1/9 feet or 7.1 repeating decimal

Step-by-step explanation:

cause it just is

A coffee company ground up 547,736 coffee beans and distributed it evenly into 560 containers. How many coffee beans are in each container?

Answers

It is 978.1 per container I’m sure
the answer is 978.1

Sam is saving digital copies of his movies on his computer. Right now, 247 movies take up 440,648 kilobytes. If each movie takes up the same amount of kilobytes, how many kilobytes does each movie take up?

Answers

Answer:

1,784 kilobytes.

Explanation:

440,648 ÷ 247 = 1,784

Answer:

Each movie would take up about 1,784 kilobytes.

Step-by-step explanation:

If you take 440,648 and divide it by 247 you get 1,784 kilobytes.

Please help this is the easiest question ever.

Answers

The answer to this question is 22

-16= -4 + w over 4 Help please lol

Answers

Answer:

w=-60

Step-by-step explanation:

-16=-4+w/4

-64=-4+w <-- you multiply both sides by 4

-60=w <-- you add both sides by -4

w=-60 <-- final answer

Melissa wants to buy a new pair of shoes that have an original price of $45. Melissa has a coupon for 20 percent off to use on them, which amounts to a discount of $9. If sales tax is 9 percent on the final price of the shoes, how much tax will she need to pay?
$3.24
$4.05
$4.86
$4.95

Answers

Answer:

$3.24

Step-by-step explanation:

First, we subtract the $9 from the $45, so that equals $36

9% of the 36% is added to the final price as tax

36 x 0.09 = 3.24

Answer:

45-9=36

what we could do is first find out how much 1% is, 36÷1=0.36.

so 0.34×9=3.24

the final answer is 3.24

what is the total length if the larger box has a length of 8 inches Amelia i-ready middle school

Answers

Answer:

Can you rephrase your question? It is incomplete

Step-by-step explanation:

V=L×W×H V=8×1 3/4×12 1/8 V=169.75in3

Is he correct, or not?

Answers

Answer:

C. His estimate is incorrect; it should be closer to 12 than 11.

Step-by-step explanation:

1. 11^2 is 121, √(140^2) is 140, and 12^2 is 144.

2. Based off these numbers 140 is closer to 144, meaning that √(140) is closer to 12 than 11.

Therefore, the correct answer is C. His estimate is incorrect; it should be closer to 12 than 11.

Answer:

He is not correct

Step-by-step explanation:

He is not smart

Identify the rule for the following pattern:

4, 24, 144...


multiply 6
multiply 6

subtract 6
subtract 6

divide 6
divide 6

add 6
add 6

Answers

4 multiplied by 6= 24
24 multiplied by 6=144

therefore, your answer is multiplied by 6!
good luck on the rest of your assessment!
Other person is right

Simplify these -1/3 + -3/8 2.6 - (-1.5) (-2.8) divided by (-1.25)

Answers

Answer:

(-1.25)(-1/3 - 3/8 2.6 + 1.5 - 2.8)

Step-by-step explanation:

From this point on it's easy

1/24, 5.96. Matrix version.

John used the following scale drawing to create a diagram of his bedroom. Each square is 1 cm. If the side of his desk that touches the wall is 3 m long, how long are the sides of the shelf that touch the walls?

Answers

Answer:

5 meter

Step-by-step explanation:

The shelf is 5 meters

what is (4)^-2? Please help I don't understand the topic and I need all the help I can get!

Answers

4^-2 = 0.0625

i typed it into my calculator and this is what i got!!
does this help at all love?
this is really easy I’m pretty sure the thing is 4 with a exponent of -2. Which just means -4 x -4 which equals 16

Let f(x)=-x-5 and g(x)=2x+3. Find the indicated value:
f(x) when x=-10

Answers

Answer:

calcular el volumen de un cilindo de 28 cm de altura y 5 cm de radio de la base

Each line represents a different rate (cost per item). Which line represents the lowest rate ?

Line A
Line B
Line C
Line D

Answers

Line A
Explanation:
line a sells 15 items but the cost of each item doesn’t rise

Answer:

I think it's line A

Step-by-step explanation:

line A sells 15 items, but the cost of each item doesn’t go up as it shows on the graph.

5/6=1/3+d
What fraction or decimal does d equal?

Answers

d =

fraction : 1/2

decimal : 0.5

5/6=1/3+d
1/3 to the same denominator
5/6=2/6+d
Minus 2/6 from both sides
3/6=d
Simplify
3/6=1/2
So d = 1/2 or 0.5
Plz give me brainliest answer

Please do a step by step problem no links please this is due today please answer them all and I will give your brainliest

Answers

Answer:

1A. Half jump

1B. 2/3 is half of 4/3

2. 4

Step-by-step explanation:

1A. The remainder of 2/3 is shown in the model by a half jump. It is a half jump because a full jump is 4/3.

1B. We know that the remainder represents 1/2 of the jogging loop because 2/3 is half of 4/3.

2. Convert 2 1/2 into a mixed number with the denominator as eighths. We then get 20/8 divided by 5/8. After that, we can see that 5/8 goes into 20/8 4 times. (5/8 + 5/8 + 5/8 + 5/8 = 20/8)

plz don't answer without a real answer brainly first to answer
Drag the numbers to order them from greatest to least, with the greatest at the to. sqrt{17} , sqrt{12} , 4.923935........, 5.03709......

Answers

Answer:

I think it's 4.923935,5.03709,{17},{12}

Step-by-step explanation:

don't get mad at me if it's wrong sry

Answer:

1. 5.03709 2. 4.923935 3. sqrt{17} 4. sqrt{12}

Step-by-step explanation:

Estimate the unit rate to the nearest hundredth

The unit rate is about $_ per egg.

Answers

Answer:

$2.40 per egg

$2.35

5 or more, round the number

Since we are rounding by the nearest hundred, the correct answer is $2.40 per egg

HELP TIME ALMOST OUT! Drag the tiles with equivalent ratios into each box, two tiles have no match

Answers

Answer: 1:8 , 15:120

2:3, 40:60

Step-by-step explanation: 1:8= 15:80

80/15=8, so it is equal to 1:8.

40:60

40/60=2/3

Answer:

all i know is that 1:8 and 15:120 are equivalent

Step-by-step explanation:

At a store, three brands of a product are sold. Brand A is offered at 6 for $0.85. Brand B is offered at 8 for $1.00. Brand C is offered at 3 for $0.50. Place the brands in order from the best buy to the worst buy.

Answers

Answer:

I think Brand C is 1 , Brand A is 2 , and Brand B is 3

THERE RATS HELP ME ….RATSS

Answers

Answer:

Ok, so the answer is 3.5

Step-by-step explanation:

From what I could see it says walked for 14 around her block 4 times so your answer is 3.5 because if (Let's call her Patricia) Patricia walked around her block 4 times in 14 minutes, we have to find the unit rate, therefore we have to divide 14 by 4 as shown below

[tex]14/4=3.5[/tex]

Thus your only viable solution is 3.5

Hope this Helps! Also, I would appreciate it if I could be rewarded with Brainliest, I work hard on these answers and I would enjoy it, you see my goal is to reach Genius status, as to provide many more helpful answers and help many more people. Even so, I hope that I have come of assistance to you!

Answer: 3.5

Step-by-step explanation: You can find this simply by dividing 14 by 4

:)

Which statement about equations with no solution is TRUE?
Any number that you substitute for the variable will result in a true statement when simplified.
You need to simplify the equation before you can substitute a number for the variable.
No matter what number you substitute for the variable, the simplification will result is a false statement.
You can substitute the number 0 for the variable, and a true statement will always result when simplified.

Answers

Answer:

I think C

Step-by-step explanation:

Identify an inequality that represents x (in inches).

Solve the inequality.
The solution of the inequality is .

Answers

Answer:

bro its 8 inchis

Step-by-step explanation:

Task 1:Different ways to represent Relations. Complete the table with the different ways.. Complete the table with the different ways.

Answers

Domains are the first sets of numbers they are also the x and the range is the second sets of number and is the y

Uma concessionária anunciou um automóvel com um financiamento “taxa zero” por R $ 68.000,00, o valor que pode ser pago em doze parcelas iguais e sem entrada. Para efetivar a compra parcelada, no entanto, o consumidor precisa pagar R $ 3.400,00 despesas extras. Dessa forma, em relação ao valor anunciado, qual é o percentual de acréscimo que o comprador?

a 7%


b 5%


c 12%

POR FAVOR AJUDEM

Answers

Answer:

68,000,00 + 3,400,00 = 9,120,00

Answer:68,000,00 + 3,400,00 = 9,120,00

Help mah with this one please too

Answers

Answer:

37

Step-by-step explanation:

-3+5(8)

-3+40

40-3=37

Answer:

The answer is 37

Step-by-step explanation:

−3+5(6+2)

=−3+(5)(8)

=−3+40

=37

Emelina wrote the equation of a line in point-slope form as shown below.

(y + 4) = 3 (x + 2)

What is Emelina’s equation in slope-intercept form?

Answers

Answer:

y=3x+2

Step-by-step explanation:

Answer:

i dont know ... sorry dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd

HELP ME i will give brainliest to first answer

Answers

X =4 y=28 you’re welcome <3

Please solve questions 6-9!! Whoever gets it right or answers first will get brainlest! PS, PLEASE SHOW WORK ON PAPER, PHONE ETC. !!

Answers

Answer:

6. 41634

7.  60214

8.  976336

6) 41,634
7) 60,214
8) 976,336
9) 166,002

Let f(x)=-x-5 and g(x)=2x+3. Find the indicated value:
x when g(x)=1

Answers

Answer:

-9

Step-by-step explanation:

few words about function notation.  If f is a function, then f(x) is the

value of the function at x, usually denoted by some sort of rule for finding

the value of the function given that you know the value of x.  f(a) would be  

the value of the function at a, and f(4) would be the value of the function at,

=4

In this case the value of the function f at x, or f(x) is given by the rule:

f(x) = -x - 5   You want to know f(4), which is the value of the function at

4, so f(4) = -(4) - 5 = -9

Answer:

fx+-x-5=2x(3+g)

Step-by-step explanation:

Other Questions
Which statement describes the word iterative? b+2.01=5.5what does B stand for which statement best describes an example of selective breeding? I lift a 20kg ball up 2.5 meters off the ground on Earth.-Earths gravitational acceleration is about 9.8 m/s2.How much gravitational potential energy does the ball have at this point? _____________How much work did I do lifting up the ball? _____________________________________If I lift the same ball the same distance on the Moon, then how much gravitational potential energy will it have? (Moons Gravity = 1.6 m/s2) ____________________________________ Which signposts uses words that have a strong connotation?-Contrast and contradictions-Extreme or absolute language -Numbers and stats Based on the maps, what region did more railroads tracks develop - the North or South? Why do you think so? Of the 180 students in Mrs. Stanfield's class,60% are girls On Thursday, 25% of the girls in theclasses dressed up for Wacky Tacky Day. How manygirls dressed up? Should English be capitalized in this sentence?Today I went to English class. A battery causes a current of 2.0 A to flow through a lamp. The power used by the lamp is 12 watts. What is the voltage? Which of the following is an example of intrinsic motivation?A.composing a piano tude for extra credit in your music appreciation course B.writing a song to perform at your parents' 25th anniversary party C.creating a mixed-media collage in hopes of winning a blue ribbon at a local art fair D.building a robot to enter in a competition that offers a $500 first prize Which option describes a research question? (1 point)O a question that identifies a topic that you want to learn more aboutO a question that reveals where you can find information about a topicO a question placed in the conclusion of an essay to me the reader thinka question that encourages the reader to find out more about the topicNo Which of the following characteristics of the planet, Earth, is essential tothe survival of every living organism?*Earth has abundant available water.O Earth has just one orbiting moon.O Earth orbits the Sun once every 365 days.O Earth rotates on its axis once every 24 hours. Two toy robots are turned on at the same time. The first robot beeps every 24 seconds. The second robot beeps every 36 seconds. In how many seconds will they beep at the same time? Choose only ONE best answer. 12 B 24 36 72 E 96 PLEASE HELP I ONLY HAVE AN HOUR LEFT !!!!!! please help me with this chem question!! Which phrases tell causes of suffering for blacks in northern cities after World War II? Choose all answers that are correct. Look at the net of square pyramid below l. What is the surface area? Solve by grouping 8x^3+3+6x^2+4x A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include "The blue whale is the world's largest animal. What other amazing feature isit known for?*A) Its the quietest animalB) Its the loudest animalC) Its the heaviest animalD) Its the lightest animalChoose one of them. Steam Workshop Downloader