NEED ANSWER ASAP!!


If you drink a chemical, What should you do?

Answers

Answer 1

Answer:

Contact poison control

Explanation:

1-800-222-1222

Answer 2
Call poison control
Call 911
Call a doctor
Get a parental guardian
Get a ambulance

Related Questions

list at least 3 effects that happen in your body while smoking marijuana

Answers

Answer:

Heavy Cough, Irritant to throat and lungs, and Brain Damage

Explanation:

Heavy cough, lung cancer, drowsiness

HELPPP MEE ASAPPP PSLSS CHOOSE THE CORRECT ONENE

some problems with the digestive system make it very difficult for the body to digest enough food. Why would it be harder to exercise when you have a digestion problem like this?

Answers

Answer:

d

Explanation:

Answer:

b

Explanation:

Enter T or F please. Thank You!

Answers

Answer:

true

Explanation:

Answer:

T.= True T. is the correct answer because take this as an example walking around your yard or your neighbor hood that would not count because you need to make your heart pound and your body ache but to be sure not to hurt your self ^_^

Explanation:

plz give brainliest and rating

HELP WITH THE MATH PLZZ, NO FAKE ANSWERS, YOU WILL GET REPORTED

Answers

Answer:

Explanation:

MARK ME BRAINLIEST

Answer:

the answer above me is right pls make him branliest ty!

Explanation:

Can anyone give me some advice? I'm kind of down right now.

Answers

it’s okay to feel down just remember whatever it is it’s not your fault and you should give yourself a break and a self care day ♡ freshen up and eat some of your favourite food then watch something that cheers you up like your favourite show! or you can rest and take it slow. just remember that you matter and it’s okay to not feel okay. it’s normal. please place yourself at top priority and i really hope you feel better ♡
hi!! if anyone hasn’t told you yet, i am so so proud of you. you’ve made it through all the bad days and will conquer some more :) keep your head up. you’re never alone

Why do babies let out loud grunts to release stool? This is for an assignment based on how diets effect our stomachs I am doing an essay.

Answers

When your baby grunts, it usually means they're learning how to have a bowel movement. They haven't yet figured out how to relax the pelvic floor while also using abdominal pressure to move stool and gas through their system.
They’re learning how to

If high blood pressure is not treated, it can damage what?

Answers

Heart/arteries can be damaged if not treated
it can damage your heart/arteries

A serving of whole grain corn meal contains how much protein? (WILL MAKE BRAINLIEST IF CORRECT ANSWER)

3 grams exactly
Just over 2 grams
A little less than 4 grams
6 to 8 grams, depending on the variety

Answers

Answer:

Nutrition Facts

Dietary Fiber 7.3g 26 %

Sugar 0.6g

Protein 8.1g 16 %

Vitamin D 0.00mcg 0 %

Explanation:

please mark this answer asthe brainlest

A serving of whole grain cornmeal contains how much protein is 6 to 8 grams, depending on the variety.

What is whole grain cornmeal?

Whole-grain cornmeal includes components of all three and thus brags a fuller, richer taste and twice the nutritional matter.

But because the germ is high in oil, wholegrain cornmeal turns sour quickly if not stored in the freezer.

Thus, 6 to 8 grams, depending on the variety is the answer as other values are less than the standard values.

To learn more about proteins click here:

https://brainly.com/question/17095120

The pituitary gland in a male child is malfunctioning. It signals the reproductive organs to secrete hormones too early. Based on your knowledge of the endocrine system and hormones, explain the likely impact of this on the male child.

Answers

Answer: Experiencing growth a lot faster as well as puberty.

Explanation: If the Pituitary glands are malfunctioning, and it sends signals to secrete hormones to early this could lead to rapid in growth and/or early growth.

Hope this helps!  Mark Brainliest if it does :)

To make a candle burn, a lit match must first be held to the candlewick. The graph shows the energy changes that happen when a candle is lit and continues to burn.

ANDDD HELP PLEASE

Answers

Answer:

The part of the graph that is rising is the prat with the mach until it goes down. The reaction is releasing energy. It may seem it is absorbing energy but it is releasing it slowly

Explanation:

Answer:

To answer #1 it is when it starts to elevate. and for #2 It releases energy, thermal energy to be exact.

Explanation:

Soon you will watch a video about an athlete whose improved performance has led some to suspect him of blood
doping Think back to what you learned about the blood doping process. What do you remember about how blood
doping works and how it could affect cellular respiration?

Answers

Answer:

well it could effect that bc blood dipping

Blood doping is basically putting more oxygenated red blood cells in the body. This is to increase the amount of oxygen that your body can intake and use, further improving aerobic ability and enhancing endurance. Therefore, with more oxygen in the body, the rate of cellular respiration increases.

Pov:: You are going for a walk and randomly a person wearing a suit runs up to you and says this ¨We´ve been trying to contact you regarding you cars extended warranty for quite some time now, this will be out final attempt to try and reach you.¨

(Someone said i needed to type more and this is all i could think of.)

Answers

Answer:

Multicellular

Explanation:

Here is an example of a multicellular organism to get a better understanding of what it looks like.

Answer:

prokaryatic

Explanation:

Why are grains important in a healthy diet?

Answers

Answer:

- Grains have fiber and antioxidants

-They help prevent diabetes and heart disease.

-They are packed with healthy carbohydrates

-They manage weight

They have vitamins

- They help improve your immune system

grains have fiber antioxidants and vitamins

The following diagram shows the branching tree for four kingdoms and some of their shared derived characteristics.

What shared characteristic can be written at point X? Use complete sentences to explain your answer.

Answers

Answer:

X=Eukaryotes

Explanation:

Electrolytes because it is at the end

Which of the following is generally included in whole grain products?

The bran
The stalk
The roots
The leaves

Answers

Answer:

Of course, the bran. Where would bread and cake be without bran?

Explanation:

The bran is generally included in whole grain products.

What is whole grain products?

Whole grain products are foods that contain all parts of the grain kernel, including the bran, germ, and endosperm. These products are an important part of a healthy diet because they provide a range of essential nutrients, such as fiber, B vitamins, minerals, and antioxidants. Examples of whole grain products include whole wheat bread, brown rice, oatmeal, quinoa, popcorn, and whole grain pasta.

Consuming whole grain products has been linked to a range of health benefits, including improved digestion, reduced risk of heart disease, diabetes, and certain cancers. It is important to choose whole grain products over refined grain products, such as white bread, which have had the bran and germ removed during processing, resulting in a loss of nutrients. Incorporating whole grain products into your diet can be a simple and effective way to improve your overall health and wellbeing.

Learn more about whole grain products, here:

https://brainly.com/question/30590678

#SPJ2

How to help someone going through trans... One of my best friends is going through it and I don't know how to support (her, well him) or even understand how to deal with it just myself...

Answers

Support there pronouns but don’t be pushy let them naturally change take her shopping but don’t pick out outfits for her let her chose stuff just be supportive
Just be there for them. Don’t let them go through the change alone always have their back and no matter what that’s your best friend no matter what happens. The appearance might change but inside it’s your best friend.

Which step leads toward conflict resolution? (I have no idea why my health teacher wants us to do this)
A: letting each person tell his or her side
B: punishing both sides until they agree
C: letting one side ask questions, but not the other
D: letting both sides fight it out after school

Answers

A - letting each person tell his or her side.
A. Allowing both sides to address the issue is the most correct. Conflict resolution allowed each party to voice their concerns and find a way resolve the conflict at the lowest level

For each of the following terms read the food preparation term on the left. Then select the word on the right that is closest in meaning.

1. arcing curving sparkling

2. bake cook dry

3. baste moist spoon

4 beat mix blade

5. blanch pale scale

6. brown color blanch

7. chop cut knife

8. coat cover jacket

9. combine blend dividie

10. cream soften milk

11. dehydration drying moisture

12. dice even cube

13. dovetail overlap separate

14. grate evaluate shred

15. marinate dressing soak

16. recipe batch instructions

17. roast uncover bake

18. sear burn brown

19. skim surface remove

20 watt power setting

21. whip polish beat

22. yield produce amount

Answers

Answer:

1,4,2,3,5,7,6,8,9,12,10,11,14,13,22,15,18,17,19,16,20,21

Explanation:

i think it is wrong but i tryed

1.2.3.4.5.6.7.8.9.10

Grains are types of grasses.

True
False

Answers

Your answer is false

Answer:

True :3

Explanation:

How is longboarding related to reaction time

Answers

Because to ride a long board, you need to react to different things like how fast you are going and when you need to turn.
Because if your long boarding and there is like a rock a pebble or a sign or smth you have reaction time to swerve away from the thing

what do all the 5 food groups have in common

Answers

they are all essential for our bodies

A cookie made with whole grains has less fat and sugar than a cookie made with processed grains.

True
OR
False

Answers

True should be right
false
i’m pretty sure that question is false.

What do u do when u and ur anonymous online bsf meets u the day of the STAAR,ugh and you think u like him...? Help no capp

Answers

Hmmmmmmm yes good idea
this is not the best situation. my advice would to be to wait it out. find out more of what he’s like in person. if you really like him then move further with your relationship. congrats on meeting your internet bsf <33 lucky uuu
Other Questions
Answer the following question in 3-4 complete sentences. A black and white photograph of a waterfall flowing over a cliff. The opening of the waterfall is at the very top of the photograph. The water falling takes up most of the frame. Tree tops are shown at the bottom of the frame. Who took the photograph above? Why was it taken? What was its purpose? 7th grade English Question An interjection can be set apart byAa comma.Ba number.Cparentheses.Dquotation marks. Find the volume of the cube shown at the right. h=6in When plants that are true breeding for different traits of acharacteristic are crossed, the trait observed in the first generationis called thea. dominant trait.b. recessive trait.c first-generation trait.d. second-generation trait. The height of a rocket is modeled by h(t) = -(4t-12)(4t-36). How long after reaching its maximum height does it take for the rocket to hit the ground?A. 3 secondsB. 4.5 secondsC. 7.5 secondsD. 12 seconds what is the product of the polynomials below? (8x^2-4x-8)(2x^2+3x+2) How many different 5-letter words can be madea. if the first letter must be A or Y and no letter may be repeated?b. if repeats are allowed (but the first letter is A or Y)?c. How many of the 5-letter words (starting with A or Y) with no repeats endin H? what information did the Zimmerman Telegram state that concern the United States when the telegram was intercepted what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? FREE BRAINLIST! Help answer my question about figurative language -Write me a figurative language sentence for each picture Answer the question in the picture plz Happy Paws charges $20.00 plus $3.50 per hour to keep a dog during the day. Woof Watchers charges $10.00 plus $4.75 per hour. Complete the equation and solve it to find for how many hours the total cost of the services is equal. Use the variable h to represent the number of hours. (the)______ edificios LasLosElLa Malcolm has decided that he wants to open up his own law practice. The time has come to establish prices for his services. Due to his extensive experience and legal background, he believes that his fees should not relate directly to the time or effort spent on specific cases. Now that Malcolm has chosen the pricing strategy he wants to use, what is his next step Does this table show a proportional relationship? If so, what is the constant of proportionality? If not, explain. How did the Sepoy Rebellion disprove the claims made in Clive's letter? O Few Indian troops ever joined to serve with the BNish. O Indian troops fought against the British because they felt poorly treated. O Indian troops refused to fight a battle that would have won India for Britain. 3. Mark each of the following statements, regarding the WTO, as true or false. If false, correct the statement. a. ______ The WTO was formed by countries that conduct the majority of international trade. b. ______ The WTO seeks to increase import quotas and reduce import and export tariffs. c. ______ The WTO seeks to eliminate restrictions on the flow of money between countries. d. ______ Though it can hear accusations, the WTO cannot order remedies Approximate the correlation of the data shown below?a.0b.1c.-0.8d.-1 Assume a company is preparing a budget for its first two months of operations. During the first and second months it expects credit sales of $48,000 and $76,000, respectively. The company expects to collect 60% of its credit sales in the month of the sale and the remaining 40% in the following month. What is the expected cash collections from credit sales during the first month You would expect a cell with extensive Golgi apparatus to Steam Workshop Downloader