List all of the pages titles from the study "African American Migration" here. Then, write a sentence or twi summarizing the main ideas of the page.

Answers

Answer 1

1.Moving all through the South - Freedmen stay near their previous ranches because of the way they were dealt with  

2.The Right to Move - Freedmen, for the most part, moved to Atlanta, Richmond, and other southern urban areas for work since they infrequently left the south.  

3.Where they Settled - Map of where African-Americans settled after the Civil War.  

4.Seeking Land - The Homestead Act is passed, and Freedmen exploit it.  

5.Moving to the City - Explains why the Cities were an intense place to live in on the off chance that you were an African American  

6.Northern Cities - Northern Cities were less demanding to move into since they bolstered equity.  

7.Promised Lands - A perspective of what spots were best to move to and their lives as free resident


Related Questions

What enlightenment thinker believed that people entered into a contract with the government?

Answers

Yes but I don’t know

Washington's smallest geographic region in terms of land size is the
O Cascade Mountains region.
O Okanogan Highlands region.
O Willapa Hills region.
O Blue Mountains region.

Answers

Answer:

O Cascade Mountains region.

Explanation:

MARKING AS BRAINLIEST ( THIS IS ABOUT THE VALLEY FORGE)!!! DBQ QUESTION IS WHY WOULD U QUIT THE VALLEY FORGE)? Do all the 4

Answers

Answer:

1)The Revolutionary War British are being fought by the colonies in America, the American colonies are fighting for their independence from Great Britain.

2) Valley forge is a location  General George Washington and his troops stayed during the winter.

3)Why would I have quit at Valley Forge.

4) I would quit Valley Forge due to the lack of proper food the poor  living quarters and terribly harsh winter.

Explanation:

PUT IN YOUR OWN WORDS.

help yea girl our nah ​

Answers

Answer:

see below

Explanation:

Main idea: Josh is very good at football

Details: He scored 6 goals this year

He kicks the ball far


Which physical feature would be found near the "1" on the map?

1 Andes Mountains

2 Atacama Desert

3 Amazon River

4 Sierra Madre Mountains


Answers

Sierra Madre Mountains. If you need to memorize it for a test or quiz, I would recommend making up phrases in your head to make it easier to remember!

Sierra MADRE MOUNTAINS is in MEXICO. All the worlds beginning with M being linked to Mexico might be a helpful way to remember.

what brought the first settlers to the west?

Answers

Answer:

New land

Explanation:

settlers where trying to find new land and what land did they discover yea the U.S.

when hitler died? which year?​

Answers

Answer:

1945

Explanation:

In world war II when the Nazi party is not win no votes.

In what way did physical geography influenced the British colonies between 1607-1754

Answers

Europeans developed a variety of colonization and migration patterns, influenced by different imperial goals, cultures, and the varied North American environments where they settled, and they competed with each other and American Indians for resources.

what force is most impactful throughout the universe

Answers

The strong nuclear force, also called the strong nuclear interaction, is the strongest of the four fundamental forces of nature.

Hope it helps!

Brainliest would be nice since I’m stuck on Ambitious but of course you don’t gotta :)

Why did the southern states secede ?

Answers

Answer:

bc they had high money crops called cash crops and had amazing soil and place to grow things with big plantations or called farms

Explanation:

your answer should be -desire to preserve the institution of slavery.

Hope that helps

What is supreme law of the land

Answers

Explanation:

The U.S. Constitution calls itself the "supreme law of the land." This clause is taken to mean that when state constitutions or laws passed by state legislatures or the national Congress are found to conflict with the federal Constitution, they have no force. Decisions handed down by the Supreme Court over the course of two centuries have confirmed and strengthened this doctrine of constitutional supremacy.

Final authority is vested in the American people, who can change the fundamental law, if they wish, by amending the Constitution or -- in theory, at least -- drafting a new one. The people do not exercise their authority directly, however. They delegate the day-to-day business of government to public officials, both elected and appoin

1. How did the Hundred Years' War affect the development of national identity?

Answers

emergence of a much greater sense of patroism and national identity


The people on this ship were
meaning they could eventually buy their freedom

Answers

Answer:

When the ships arrived, their passengers were sold at auction and set to work. Thus, African people were bought and sold. Enslaved people were seen not as people at all but as commodities to be bought, sold and exploited. Though people of African descent — free

What are the geographic characteristics of Africa?
Why is Africa considered the birthplace of humanity?

Answers

Answer:

Africa is a tropical place filled with a variety of landscapes such as rainforests, tropical deserts, and savanna grasslands. Since scientists and archeologists have, over the years, found many more human-like fossils in Africa than anywhere else in the world (many of them being older than other fossils found in other regions) they have concluded that early humans have originated from Africa.

My personal thought for the second question, is that early humans (before modern humans) inhabited Africa long before they spread out to the other continents. They lived there, where some evolved into more "anatomically correct" humans, and thus Africa was not only the only known home of our early ancestors, but it was and can also be considered the birth place of modern day homosapiens. I assume this is already tying into what I said earlier, but I just felt like bringing it up. Anyways I hope this answer isn't too lengthy for ya :)

(Because, you really only need the top part.)

What was Peter Olive's address about

Answers

Answer:

An Address to the Soldiers of Massachusetts Bay who are now in Arms against the Laws of their Country.

Explanation:

explain how a lobbyist might try to influence the government in at least 3 ways

Answers

Answer:

I don't know the answer:

100 POINTS!!!


Please match the correct word to the correct definition.

Merchant


Playbooth Theater


Bruton Parish Church


Governor's Palace


Market Square


College of William and Mary


Publick Hospital


Gaol


Capital Building


Duke of Gloucester Street


Publick Houses


Magazine

1.
The main street that, ran the length of a mile, between the College of William and Mary and the Capital.

2.
What building at Williamsburg is two-stories tall and shaped like the letter H. Many historic events leading up to the Revolution would happen here.

3.
Second oldest institution of higher learning in America. It educated many early presidents.

4.
Used to store equipment, arms, munitions, and powder for colonial militia forces.

5.
Served as a place where people could attend auctions, sell their wares, and trade. There would often be various types of entertainment here too.

6.
This impressive building, over 3,300 square feet in size, was built to show off the power and the prestige of the crown of Britain. Was a social center for the fashionable and the social elite.

7.
Ordinaries, Taverns, and Inns. People could eat, drink, socialize and conduct business, stay the night and have their horses cared for.

8.
Occupation found in Williamsburg and in many larger towns that was not a skilled trade.

9.
Early important building at Middle Plantation, served as a storehouse and hospital during the battle of Yorktown, and is still being used today.

10.
This location was the first of its kind in British America. Many play from England were done here.

11.
Used to hold debtors, runaway indentured servants and enslaved people, and at one time, several of the crew of the pirate Blackbeard.

12.
Used to treat and house the mentally ill. First building in North America dedicated to the treatment of the mentally ill.

Answers

Answer:

5. Market Square

12. Publick Hospital

1. Duke of Gloucester Street

10. Playbooth Theater

2. Capital Building

6. Governors Palace

11. Gaol

3. College of William and Mary

9. Bruton Parish Church

7. Publick Houses

8. Merchant

4. Magazine

Explanation:

Immersive Reader
4
Which of these statements best describes Christian
missionaries' Impact on the native people of South
America?
A
Missionarles protected individuals, often at the cost of the
native culture
B
Missionaries helped conquistadors enslave the native
people
С
Missionaries helped native people protect their own way of
life
D
Missionaries had little Impact on native people, good or
bad

Answers

Missionaries protected individuals, often at the cost of the native culture

Missionaries protected individuals, often at the cost of the native culture. Hence, option A is appropriate.

What is the meaning of Missionaries?

A missionary is indeed a member of a religious organization who is sent into a community to spread their religion or offer services to the local populace, such as economic growth, education, health care, and social justice.

To spread the Christian religion and the teachings of Jesus Christ, missionaries enter local communities. Depending on where a missionary or group of missionaries are traveling, their work will vary (international or local communities). The absolute least, a missionary's duty to God comes before that to his as well as her church or missionary organization.

A missionary is a person who goes to another country to do good deeds and, most frequently, to try to convert individuals to their religion. A missionary is an individual who travels on a mission, and a missionary is an adjective that describes the work that is done on such a journey.

Hence, option A is correct.

Learn more about the Missionaries here:

https://brainly.com/question/25815229

#SPJ6

Which development occurred during the golden age of the Middle Kingdom?
a change in religious beliefs
a rise in pyramid construction
an increase in military conquests
an explosion of cultural creativity

Answers

Answer:

d

Explanation:

Answer: It's D

Explanation:

because i took the test.

6.
What made Makkah an important religious center?
Pls help

Answers

Answer:

Makkah is where Prophet Mohammed received his first revelation from God. The Kaaba is also in Makkah, which is where Muslims go for Hajj.

Explanation:

Makkah (or Mecca) is important because it is the place where Prophet Mohammed is said to have received his first revelation from God (Allah).

The Kaaba is located in Mecca, which is where Muslims go to complete Hajj.

Hope this helps! :) If you have any questions about my answer, just comment!

Much of interior’s character of the St. Peter’s basilica in the Vatican is the result of the work of...
a. Francesco Borromini
b. Gian Lorenzo Bernini
c. Giacomo della Porta
d. Domenico Fontana

Answers

Answer:

Gian Lorenzo Bernini

The two divisions within Islam are
Sunni and Shia
Shia and Bedouin
Sunni and Kharijite
O Fatimid and Abbasid

Answers

Answer:

Sunni and Shia

Explanation:

It was the Sunni and Shia

Which country resented the number of French and British colonial holdings?
O Italy
O Spain
O Germany
O Portugal

Answers

Spain because they were originally the greatest power in Europe

Answer: germany  i know bc i took the quiz

!!!!!!!!!! Helppppppppppppppp

Answers

The answer is d
“Purification after death redirects here. For the practice of cleaning the bodies of the recently deceased observed by various cultures”

HELPP!!
Why did China want to participate in World War I, and what was the outcome?

Answers

its major aim was to earn itself a place at the post war bargaining table and declared war against Germany and Austria-Hungary Empire.

According to Bartolomé de las Casas, what was an effect of the Spanish
arrival in the Americas?

Answers

Answer:

De Las Casas uses diction (word choice) to create a tone of outrage. He is angry at the injustices being done to the Natives. He uses phrases such as “the bloody slaughter and destruction of men,” “making them slaves, and ill-treating them,” “laid violent hands on the Governours,” and “exercise the bloody butcheries.” De Las Casas conveys immediate physical violence through words like “bloody,” “destruction,” “violent,” and “butcheries.” He conveys short and long-term violence, including the losses of liberty and culture, through words like “slaves” and “ill-treating.”

Explanation:

I hope this helps you in any shape or form.

Answer:

Bartolome de Las Casas, early Spanish historian and Dominican missionary who was ... Europeans in the Americas and to call for the abolition of slavery there.

Explanation:

How to keep your falaj clean

Answers

Answer:

you use sponge and masaha

Describe the main foreign policy challenges based by president Obama during his time in the White House

Answers

Answer:

The president has the power to nominate ambassadors and appointments are made with the advice and consent of the Senate. The State Department formulates and implements the president's foreign policy. Learn more about ambassadors, diplomatic history, and American embassies.

Explanation:

What was the Safavid Empire known for? NEED ANSWER ASAP!!!!
A. a new set of laws for the empire


B. a magnificent domed mausoleum called the Taj Mahal


C. a grand and well-planned capital at Isfahan

Answers

The answer is be a magnificent doomed mausoleum called the Taj Mahal

Ancient civilizations including the Mesopotamian empires of Sumer and Babylon, Egypt, and India have all influenced the modern Western world. Which of these ancient civilizations has had the greatest impact on the Western world? Write an essay that argues your viewpoint on this topic. Support your claim with reasons and evidence. PLEASEEEE HELP THIS IS PREWRITING BTW

Answers

Answer:

I'm not gonna write you a whole entire essay but I'll give you some main points. The kings/pharaohs and social class system of the ancient middle eastern world directly influenced the governments of western empires. The social class system of ancient egypt influenced the social class system of most empires in the west. In egypt you have slaves and peasants on the bottom. Artisans, soldiers, and merchants in the middle. Aristocrats, priests, and the Pharaoh in the top. This social pyramid has been replicated by the western empires. The advanced agricultural systems such as irrigation also influenced agriculture in the western world. The Egyptians and ancient middle eastern empires mastered agriculture using innovative irrigation systems.

Other Questions
what information did the Zimmerman Telegram state that concern the United States when the telegram was intercepted what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? FREE BRAINLIST! Help answer my question about figurative language -Write me a figurative language sentence for each picture Answer the question in the picture plz Happy Paws charges $20.00 plus $3.50 per hour to keep a dog during the day. Woof Watchers charges $10.00 plus $4.75 per hour. Complete the equation and solve it to find for how many hours the total cost of the services is equal. Use the variable h to represent the number of hours. (the)______ edificios LasLosElLa Malcolm has decided that he wants to open up his own law practice. The time has come to establish prices for his services. Due to his extensive experience and legal background, he believes that his fees should not relate directly to the time or effort spent on specific cases. Now that Malcolm has chosen the pricing strategy he wants to use, what is his next step Does this table show a proportional relationship? If so, what is the constant of proportionality? If not, explain. How did the Sepoy Rebellion disprove the claims made in Clive's letter? O Few Indian troops ever joined to serve with the BNish. O Indian troops fought against the British because they felt poorly treated. O Indian troops refused to fight a battle that would have won India for Britain. 3. Mark each of the following statements, regarding the WTO, as true or false. If false, correct the statement. a. ______ The WTO was formed by countries that conduct the majority of international trade. b. ______ The WTO seeks to increase import quotas and reduce import and export tariffs. c. ______ The WTO seeks to eliminate restrictions on the flow of money between countries. d. ______ Though it can hear accusations, the WTO cannot order remedies Approximate the correlation of the data shown below?a.0b.1c.-0.8d.-1 Assume a company is preparing a budget for its first two months of operations. During the first and second months it expects credit sales of $48,000 and $76,000, respectively. The company expects to collect 60% of its credit sales in the month of the sale and the remaining 40% in the following month. What is the expected cash collections from credit sales during the first month You would expect a cell with extensive Golgi apparatus to A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statements is supported by the phylogenetic tree shown here? Select ALL that apply.A) M. bicolor and M. parma are in the same subspecies category. Eliminate B) M. agilis and M. eugenii share the most recent common ancestor.C) T. thetis and P. xanthpus share the most characteristics in common. D) T. thetis and P. xanthpus share the greatest number of taxa levels than other species. E) M. agilis and M. eugenii share the greatest number of taxa levels than other species. A die with 8 sides is rolled. What is the probability of rolling a number less than 3 8) Lisa and Jasmine are selling cheesecakes for a school fundraiser. Customers can buy pecancheesecakes and apple cheesecakes. Lisa sold 3 pecan cheesecakes and 7 apple cheesecakes for atotal of $130. Jasmine sold 12 pecan cheesecakes and 14 apple cheesecakes for a total of $338.Find the cost each of one pecan cheesecake and one apple cheesecake. 2. Which country began studies on bioterrorist weapons in the 1930s? Whatwas the program known as? How did other countries respond to this?3. Why is plague attractive as a bioterrorism weapon?4. How did the English use smallpox during the French and Indian War?5. Which country loaded botulism toxins into bombs? Why is botulism of lessconcern than anthrax or plague?6. What animal is tularemia most associated with? How can humans becomeinfected? In what ways might it be transferred to humans as a bioterrorismweapon?7. Why do you think countries or groups might use these diseases asbioterrorist weapons? What advantages would they have over other types why did some people turn toward democratic forms of government during this time i need help to pass math What was at the center of the Greek house?A. The family roomB. The kitchenC. The andronD. The courtyard Steam Workshop Downloader