Answer:
Nitrogen
Explanation:
Nitrogen makes up 78% of the atmosphere, while oxygen makes up only 21% and other gases make up around 1%
Answer:
nitrogen
Explanation:
It's a mixture of different gases. The air in Earth's atmosphere is made up of approximately 78 percent nitrogen and 21 percent oxygen.S
hope it helpHow do scientists exploit the plasmids in bacteria?
A) They multiply the cells.
B)They use them as vectors.
C)They express plasmids.
D)They nullify their effects.
Answer:
C
Explanation:
Primers can be exploited for sequence verification of plasmids
Answer: B: They use them as Vectors.
Explanation:
I took the test.
*MAY* give brainliest!
Please give answer and explain:
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.
Group of answer choices
ATTTGCAATACTACCGGGC
ATGAATGCATACTACCGGGC
ATTTGCATACTGACCGGGC
ATTTGCAACTACCGGGC
ATTAGCATACTACGGGC
Answer:
which are the letters with hightlight yellow?
Help !!!!!!!!!!!!!!!!!!!!!
Answer: I would say D or the last answer
Explanation:
The process of making proteins is called
Answer:
translation
Explanation:
Answer:
Translation
Explanation:
What process allows Na+ and K+ to move in and out of the cell simultaneously?
ANSWERS:
A.Simple Diffusion
B.Facilitated Diffusion
C.Active Transport
D.Osmosis
Answer:
The correct answer is: C. Active Transport.
Explanation:
Because Na+ and K+ are ions, which makes them charged molecules, they can only diffuse through the cell membrane when using specialized protein channels. This is called facilitated diffusion and is a form of passive transport because sodium and potassium move following their gradients, which are made of the difference in concentration between the inside of the cell and the outside of the cell. For example, potassium is highly concentrated inside the cell and poorly concentrated outside the cell, so potassium diffuses from the inside to the outside to even the concentrations.
But the question asks in which process Na+ and K+ move in and out of the cell SIMULTANEOUSLY, so the answer is actually active transport. Active transport is the opposite of passive transport. While passive transport occurs naturally and doesn't need ATP (energy) to happen, active transport needs ATP because it moves molecules AGAINST their gradient. One of the most famous and important structures involved in active transport is the Na+/K+ pump, which consists of a specialized protein using energy to enter 2 potassium ions and take out 3 sodium ions at the same time. This Na+/K+ is fundamental to maintain the gradients, which are important for the correct functioning of many cells.
why producing 1 kg of beef requires much more water than growing 1 kg of potatoes?
Answer:
Meat production requires a much higher amount of water than vegetables. IME state that to produce 1kg of meat requires between 5,000 and 20,000 litres of water whereas to produce 1kg of wheat ...
Explanation:
Answer:
compared to beef vegetables require less water like potatoes it takes 287 litres of water
What properties of carbon explain carbon’s ability to form different large and complex structures?
Examine the following list of questions.
1. Why are kids afraid of ghosts?
2. Should I feed the raccoons that visit my trash can?
3. How does mouse color affect mouse survival?
4. Does a mother duck love her babies?
Which statement correctly identifies the scientific question and describes why the question is scientific?
Answer:
I think it is 3
Explanation:
The other questions can be explained as an opinion but 3 can be studied and it can be experimented.
Which organelle houses the genetic material DNA?
Answer:
Image result for Which organelle houses the genetic material DNA?
nucleus
The nucleus is a membrane-enclosed organelle, found in most eukaryotic cells, which stores the genetic material (DNA).
Explanation:
Nucleus is the organelle that houses the genetic material DNA.
What do you mean by organelle?
"An organelle is a subcellular structure that has one or more specific jobs to perform in the cell, much like an organ does in the body."
What do you mean by genetic material?
"Any material of plant, animal, microbial or other origin that carries genetic information and that passes it from one generation to the next is called genetic material."
What do you mean by DNA?
"DNA or deoxyribonucleic acid is a long molecule that contains our unique genetic code."
What is called a nucleus?
"A nucleus, as related to genomics, is the membrane-enclosed organelle within a cell that contains the chromosomes. An array of holes, or pores, in the nuclear membrane allows for the selective passage of certain molecules (such as proteins and nucleic acids) into and out of the nucleus."
To know more about organelle, genetic material and DNA here https://brainly.com/question/16653190
#SPJ2
are lipids that serve as chemical messengers.
a
RNAs
b
Enzymes
C Steroids
d Proteins
Check it
Answer:
C. Steroids
Explanation:
Some lipids such as steroid hormones serve as chemical messengers between cells, tissues, and organs, and others communicate signals between biochemical systems within a single cell.
Answer:
steroids
Explanation:
so c
Would the construction of this master-planned community impact the carrying capacity of the state’s ecosystem?
Answer:
Are you against or with?
Explanation:
,.;1q23wt4y5eu6ri7ertyur
Help PLEASE!!!!!!
Just as energy flows through an ecosystem, matter also moves from organism to organism and from organisms to the environment. Using either a kelp forest or a hydrothermal vent ecosystem as an example, explain how carbon can move through the organisms
Answer:
The seaweed in the Kelp forest goes through photosynthesis, takes in carbon, other organisms eat the seaweed and take in the carbon.
Search the NIH gene database for the term colorblindness. Use the results of the database search to explain how a father and mother who are not colorblind could have a son who is colorblind. Your model can be a pedigree chart, a Punnett square, or a diagram of chromosomes.
Answer/Explanation:
Red/green colorblindness is a recessive, X-linked condition. That means that the affected gene is on the X chromosome, and that the phenotype will only be present if there is no "healthy" gene, which is dominant to the mutated gene.
For two unaffected people to have an affected son, the mother must be a carrier. Remember, females have two X chromosomes and males have one. So if a female is a carrier of the colorblindness mutation, she will have one copy of the mutation and one normal copy of the gene, and will therefore be unaffected.
The punnet square (attached) shows that all their female children would be unaffected (have the B gene), but 1:2 male children would be colorblind, as their only copy of the gene is mutated (b).
Answer:
The person on top is awesome appreciate!!
Explanation:
got it right on edmmentum
Six white-tailed deer and six sika deer were enclosed in a pasture for observation during an eight-year study in central Texas. White-tailed deer are a native species to central Texas, while
sika deer are a nonnative species to central Texas. White-tailed deer feed on flowering plants and the tips of trees and shrubs but do not eat grass. Sika deer feed on flowering plants, the
tips of trees and shrubs, and grass. All other grazing animals were kept out of the pasture during the study. The number of sika deer more than doubled after the eight years, while the
population of white-tailed deer decreased by 50 percent.
Which of the following statements best supports the results from the study?
A
The sika deer are generalists, while the white-tailed deer are specialists.
B
The sika deer out competed the white-tailed deer in consuming flowering plants and shrubs.
с
Parasites infected the sika deer population but did not infect the white-tailed deer population
D
Change in the local climate reduced the availability of food resources for the white-tailed deer population
Kiki
B. The sika deer out competed the white-tailed deer in consuming flowering plants and shrubs.
Which reason best explains why dead specimens must be used with transmission electron microscopes?
A.) Electrons pass over the specimen.
B.) The lights that are used are harmful to the specimens.
C.) Specimens are placed in a vacuum.
D.) The image that is produced is two dimensional.
Answer:
C. Specimens are placed in a vacuum
Answer:
C. Specimens are placed in a vacuum
Explanation:
Since transmission electron microscopes must be used in a vacuum the specimen cannot be living. In a vacuum, there is no oxygen so nothing could survive it.
Which of the following statements is correct? *
Protons are found in the nucleus of an atom
Neutrons are negatively charged
Protons are negatively charged
Electrons are found in the nucleus of an atom
The Big Bang Theory is an example of which kind of theory of creation of the
universe?
Expansion
Steady State
Unchanging
Moving
why are index fossils useful to geologist
a.they tell the relative age of the rock in which they occur
b. they tell the ages of many different rock layers
c.they tell the age of the rock at one location only
d. they tell the absolute age of the rock in which they occur
Answer:
Explanation:
Index fossils (also known as guide fossils or indicator fossils) are fossils used to define and identify geologic periods (or faunal stages). Index fossils must have a short vertical range, wide geographic distribution and rapid evolutionary trends.
Index fossil, any animal or plant preserved in the rock record of the Earth that is characteristic of a particular span of geologic time or environment. A useful index fossil must be distinctive or easily recognizable, abundant, and have a wide geographic distribution and a short range through time. Index fossils are the basis for defining boundaries in the geologic time scale and for the correlation of strata. In marine strata, index fossils that are commonly used include the single-celled Protista with hard body parts and larger forms such as ammonoids. In terrestrial sediments of the Cenozoic Era, which began about 65.5 million years ago, mammals are widely used to date deposits. All of these animal forms have hard body parts, such as shells, bones, and teeth, and evolved rapidly.
Why do you think the size of a white dwarft affects its visual luminosity?
Answer:
White Dwarfs are extremely difficult to detect as they are quite small compared to a Star. If the area is small the Luminosity is low, which would make it harder to see the white dwarfs due to the low amount of its luminosity.
Explanation:
which I true of the rock layers shown below
Answer:
C
Explanation:
The fossil can get lifted due to water and other components
When and how were the first trans fats made with vegetable oil?
Answer:
Artificial trans fat dates back to the early 1900s when German chemist Wilhelm Normann found that liquid vegetable or fish oils could be treated with hydrogen gas to make them solid or semi-solid.
Why is using the presence of chromosomes inside of a cell NOT a reliable method to
determine if the cell is a prokaryote or a eukaryote?
Because both prokaryotic and eukaryotic cells have chromosomes (prokaryotes, and more specifically, bacteria, generally have just one chromosome, but there are some bacteria as well as archaea—which are also prokaryotes—that have multiple chromosomes).
Since the chromosomes are DNA molecules present in both the prokaryotic and eukaryotic cells, it is not a reliable method to determine if a cell is prokaryotic or eukaryotic
The nucleus of a eukaryotic cell is bounded by internal membrane, therefore, it is distinctive.
In contrast, the nucleus of a prokaryotic cell lacks internal membrane, hence its nucleus is not distinctive.
Chromosomes are Deoxyribonucleic (DNA) molecules that carry genetic information of a cell or organism.
The chromosomes are present in both the eukaryotic and prokaryotic cells. Chromosomes present in the eukaryotic cells are called eukaryotic chromosomes while chromosomes present in the prokaryotic cells are called prokaryotic chromosomes.
Since the chromosomes are DNA molecules present in both the prokaryotic and eukaryotic cells, it is not a reliable method to determine if a cell is prokaryotic or eukaryotic
Learn more here: https://brainly.com/question/2088739
What is the molecule depicted in the figure above and in which organelle would it most likely be created?
A. ATP, the mitochondria
B. ATP, the nucleus
C.ADP, the chloroplast
D. ADP, the ribosome
Answer:
The answer is A.
Explanation:
ATP, the mitochondria
The molecule depicted in the figure above is ATP and the cell organelle in which it would most likely be created is: the mitochondria.
Cell organelles can be defined as the internal organs that are typically responsible for the performance of various functions (tasks) within the body of a living organism such as an animal, plant, and humans, especially for the survival of the organism.
Some examples of cell organelles found in the body of living organisms include the following:
Nucleus. Cytoplasm. Cell membrane. Chromosome.Endoplasmic reticulum (ER). Golgi apparatus (bodies).Vesicles.Mitochondria.Mitochondria is commonly referred to as the "power house" of a cell because it is saddled with the responsibility of providing and transforming all of the energy required by living organisms in the form of adenosine triphosphate (ATP).
In conclusion, it is very important that energy (ATP) is provided by mitochondria for the survival and optimum performance of a living organism.
Read more: https://brainly.com/question/19559847
You're enjoying playing with your neighbor's new kittens. You notice than some of them look identical to the mama cat, while others looks different from the mom and from each other. You remember from your science class that traits are inherited from parents. All BUT ONE of these traits is inherited.
Answer:
The answer is WEIGHT
Explanation:
HELP PLEASE
Each myofibril is made up of arrays of parallel filaments. The thickbands are called _____ and the thin bands are called _____.
Answer:
A band , I band
Explanation:
YOURE WELCOMEEE
Which statement describes gravity?
There is no defined unit of measurement for gravity.
Gravity is the force that pulls objects toward Earth’s center.
Objects that have a small mass will have no gravitational pull.
Gravitational pull between two objects decreases as the mass of one increases.
Answer:
The answer is B. Gravity is the force that pulls objects toward Earth's center.
Explanation:
Gravity is the force by which a planet or other body draws objects toward its center. The force of gravity keeps all of the planets in orbit around the sun.
Answer:
Gravity is the force that pulls objects toward Earth’s center
Explanation:
which organelle in the cell maintains homeostasis
i need help asap please
15 points
Answer:yes that is right you got it
Explanation:
Answer:
its D
Explanation:
photosynthesis happens with thy sun
Which of the following college courses would be necessary when obtaining a degree in risk management?
Advanced Decision analysis
Pharmacology
Microbiology
Basic anatomy
Answer:
A. Advanced Decision analysis
Explanation:
Risk management can be defined as the process of identifying, evaluating, analyzing and controlling potential threats or risks present in a business as an obstacle to its capital, revenues and profits. This ultimately implies that, risk management involves prioritizing course of action or potential threats in order to mitigate the risk that are likely to arise from such business decisions.
Hence, the college course which would be necessary when obtaining a degree in risk management is Advanced Decision analysis because it will help you to measure, analyze and build decisions such as cluster analysis towards risk management and analysis.
Answer:
Advanced decision analysis
Explanation:
I took the quiz on edge
describes natural selection?