In a certain plant, the allele for red flower color (R) is dominant over the allele for white flower color (r). A cross is performed between a plant with red flowers and a plant with white flowers. The offspring are 47 plants with red flowers and 51 plants with white flowers. What are the genotypes of the parent plants?

Answers

Answer 1

Answer:

Rr and rr

Explanation:

The genotypes of the parents would be heterozygous red (Rr) and true-breeding white (rr).

Since the allele for the red flower color (R) is dominant over that of the white flower color (r), for a cross to produce both red and white flower color plants, the red parent must be heterozygous (Rr) and the white parent true-breeding (rr).

       Rr    x    rr

   Rr    Rr    rr    rr

Rr = red

rr = white

If the red parents is true-breeding

        RR    x    rr

      Rr    Rr   Rr    Rr

All their offspring would be red without any white flower color.

Hence, the genotypes of the parent are Rr and rr.


Related Questions

At the beginning of the film, director Ron Howard shows two contrasting scenes: The deaths of the Apollo 1 crew and a party celebrating the landing of Apollo 11 on the moon. How do these scenes foreshadow the rest of the movie?

Answers

Answer:

It foreshadows that the Apollo 11 made it to the moon, while Apollo 1 did not

Explanation:

1. Even though the atom is made of charged particles, it is still neutral Explain why. (1 point)

Answers

Answer:

An atom is electrically neutral (overall charge is zero) since the total number of protons is equal to the total number of electrons.

Hope this answered your question :)

please help me Which example is a trace fossil?

dinosaur footprint


dinosaur bone


dinosaur egg


shark tooth

Answers

Dinosaur egg would be your answer.

Answer:

Dinasour footprint

Explanation:

6 grade science

what are the two main organs involved in the respiratory system?​

Answers

Answer: The respiratory system is the network of organs and tissues that help you breathe. It includes your airways, lungs, and blood vessels. The muscles that power your lungs are also part of the respiratory system.

Explanation: Your respiratory system is the network of organs and tissues that help you breathe. This system helps your body absorb oxygen from the air so your organs can work. It also cleans waste gases, such as carbon dioxide, from your blood. Common problems include allergies, diseases or infections.

What is the respiratory system?

The respiratory system is the network of organs and tissues that help you breathe. It includes your airways, lungs, and blood vessels. The muscles that power your lungs are also part of the respiratory system. These parts work together to move oxygen throughout the body and clean out waste gases like carbon dioxide.

nose and lungs i think

Peppered moths have learned to stay still (not move) on a tree trunk during daylight hours to avoid being eaten by birds. This is an example of...
A. Natural selection
B. Behavior adaptation
C. Structural adaptation
D. Selective breedeinh

Answers

Answer:

Behavior adaptation

Explanation:

Behavior adaptation is where a animal behaves in a different manner that suits its environment or keeps the animal safe

The spinal cord relays messages between the body and the brain. These messages control body functions like movement, bladder and bowel control and breathing. Each vertebra has a pair of spinal nerves that receive messages from the body (sensory impulses) and send messages to the body (motor impulses). The spinal nerves are numbered 1 to 55 from the neck down. The first eight as seen here are the vertebrate and send messages to the back of the head, neck, shoulders, arms, hands and diaphragm. A) cervical B) lumbar C) sacral D) thoracic​

Answers

The Correct answer is C

As you observe an unknown cell under a microscope, you make the following observations..

Answers

it is probably a plant cell because it has a cell wall and chloroplasts.

Answer:

It is a plant cell that is being observed

Explanation:

With in the cell, there are chloroplasts that ONLY a plant cell has. It also has a cell wall which an animal cell does not, so it is clearly not an animal cell.

Adaptations of plants in different climatic conditions in Telangana

Answers

Explanation:

Note, Telangana is known to be an area whose climate is usually semi-arid, that is, it is an area that is dry and receives some small amount of rain.

Thus, plants in the Telangana region would usually possess  the following adaptive features;

ability to survive under extreme heatgrowing longer roots than normal in other to find water in the soilefficient water conservation especially in their stems.

plzzz help i willl give you a Brainliest if you get it correct

Most scientists come up with questions to investigate out of the blue.

1.true

2. false

Answers

The answer is False

Answer:

the correct answer is false.

In the water cycle, water returns to the ground as precipitation. How does phosphorus return to the soil in the phosphorus cycle?
A.
Phosphates found in soil dissolves in water.

B.
Phosphates are absorbed by the roots of plants.

C.
Animals eat the plants that absorbed the phosphates.

D.
Animals that ate the plants die and decompose.

Answers

Answer:

D

Explanation:

Bones provide attachments that allow skeletal muscles to cause movements? True or false

Answers

Answer:

True ...........................

this is a cell not a plant, because the cell do not contain________

Answers

Answer:

Chloroplast.

Explanation:

This is what I believe it is since we're obviously talking about an animal cell and NOT a plant cell like it says. Animal cells do not contain chloroplast.

If this is the answer you're not looking for, let me know! Hope this helped! :)))

Replication, Transcription, and Translation Chart

Please answer


DNA Replication:

1。Template Strand: Start with this nucleotide chain.

TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC



2。Complementary DNA Strand: Write directly below template strand.


Transcription:

3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).



Translation:

4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).



5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).



6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).

Answers

Answer:

jnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Explanation:

WILL GIVE BRAINLIEST!!!!!!!!!
In all living things, the presence of what structure supports the cell theory.

cell membrane

chloroplast

cell wall

vacuole

Answers

Answer:

chloroplast

Explanation:

Answer: the cell membrane

Why are elements called
the building blocks of matter?
A. They stack up nicely.
B. They make-up all matter.
C. They make-up most of the matter around us.

Answers

Answer:

B

Explanation:

B. They make up all matter

Which of the following is NOT produced by
respiration
sugar
Ds ATP energy
carbon dioxide
water

Answers

Answer:

I think its water or sugar.

Does eukaryotic cells need more lipids than prokaryotic cells

Answers

Answer: yes because they need more energy

Explanation:eukaryotes are more complex than prokaryotes

What is the function of cholesterol?

to keep the cell membrane from falling apart
to line the arteries of organisms
to store energy
to give us quick energy

Answers

Answer:

to store energy

Explanation:

Its main function is to maintain the integrity and fluidity of cell membranes and to serve as a precursor for the synthesis of substances that are vital for the organism including steroid hormones, bile acids, and vitamin D. Cholesterol is essential for making a number of critical hormones, including the stress hormone cortisol. Cholesterol is also used to make the sex hormones testosterone, progesterone, and estrogen. 2 The liver also uses cholesterol to make bile, a fluid that plays a vital role in the processing and digestion of fats.

when using a solar powered calculator what source of energy is being used to power the calculater

Answers

Answer:

UV rays

Explanation:

Solar energy and solar rays is what powers the calculator

the process of which cells make proteins is called protein what?

this is a fill in the blank!

Answers

Answer:

protein biosynthesis

Explanation:

prove me wrong

Answer:

any of a class of nitrogenous organic compounds that consist of large molecules composed of one or more long chains of amino acids and are an essential part of all living organisms, especially as structural components of body tissues such as muscle, hair, collagen, etc.

Explanation:

I will mark brainest if you get it right
A photovoltaic cell captures ____ to be used for power.
A. Wind
B. Water
C. Coal
D. Sunlight

Answers

Answer:

D. Sunlight

Explanation:

Answer:

santa claus

Explanation:

I NEED HELP

1. What are chromosomes?
2. What are the four phases of mitosis, in the correct order?
3. In what phase of mitosis are chromosomes moving toward opposite sides
of the cell?
4. Compare the two nuclei that form as a result of mitosis?
5. What is cytokinesis, and when does it occur?

Answers

Answer:

1. a chromosome is a dna strand that has genes

2. prophase, metaphase, anaphase, telophase

3. anaphase

4. the two nuclei are identical daughter cells and they have the same number of chromosomes

5. this is when the cell separates forming two new daughter cells and it occurs in the late telophase of mitosis.

sorry if this is wrong but this is how i learned it! hope it helps!

Explanation:

When writing experimental results, be sure to ALWAYS
A)
include the equipment used
B)
include any mistakes you made
include appropriate units on any mathematical results
D
include the names of the people who performed the lab experiment

Answers

Answer:

All of the above

Explanation:

Should include any equipment that you would need to use. Since it is an experiment you should include any mistakes you made during the experiment.

Choose all the answers that apply.
Binary fission _____.
is the type of reproduction used by bacteria
occurs in organisms that do not have a membrane bound nucleus
is a type of sexual reproduction creates identical copies of the parent cell
is a type of asexual reproduction

Answers

Answer:

A, B, D

Explanation:

Binary fission occurs primarily in prokaryotes, but can occur in eukaryotes. It is used by bacteria and is asexual reproductio, not sexual.

Explanation:

occurs in organisms that do not have a membrane bound nucleus. Explanation: Binary fission is an asexual mode of reproduction. As it does not involve formation and fusion of gametes.

In non-mendelian genetics, humans have 4 blood types in which A and B are codominant and o is recessive. I cross two parents with type AB blood. What is the percentage of children with type B blood?

A. 0%
B. 25%
C. 50%
D. 100%

Answers

Answer:

i think it may be 50 dont be mad if im wrong

Explanation:

recessive takes over from what i read i dont see any o so it can be half a half b so 50...

What is a niche, and how does it relate to evolution?

Answers

Answer:

The evolution of species’ niches is a process that is fundamental to investigations in numerous fields of biology, including speciation, community assembly, and long-term regional and global diversification processes. It forms the nexus between ecological and evolutionary questions. Topics as diverse as ecological speciation, niche conservatism, species coexistence, and historical biogeography all rely on interpreting patterns and drivers of species’ niches through time and across landscapes. Despite this importance, a distinct research agenda concerning niche evolution as a discrete topic of inquiry has yet to emerge. Niche evolution is often considered as a sidebar or of secondary importance when addressing questions such as “how did two species diverge?” Basic questions such as “what is a niche,” “what is the biological basis of niche evolution,” “at what scale should we evaluate niche evolution,” and “how can we observe niche evolution at different timescales” have rarely been addressed directly, or not at all in some systems. However, various intellectual threads connecting these ideas are evident in a number of recent and historical publications, giving some semblance of form to a framework for interpreting and evaluating niche evolution, and outlining major areas for future research from an evolutionary perspective. There is a reverse perspective from the macroecological scale as well, with questions involving coexistence, distributions and ranges, food webs, and other organismal attributes

Explanation:

ye

What is the value of the expression 3 divided by 3/4

Answers

Answer:

4

Explanation:

If we have the expression, 3/3/4.

Then this is the same as 3 × 4/3

Which is the same as 12/3

Which is the same as 4

Hence the value of the expression 3/3/4 is 4

Why is sickle cell anemia so harmful to its carriers?

Answers

Answer: BECAUSE IT MAKES THE RED BLOOD CELLS SHRINK

Explanation:

Answer:

Sickle cell anemia is harmful to the body because it is enagering your spleen and with less healthy red blood cells circulating in the body, you can become chronically anemic.

Sickle cell anemia puts your body at more risk for infection.

Explanation:


Please help me with this and answer correctly.
Brainliest will give!! ​

Answers

Answer:

Sorry can't help

Explanation:

PLEASE GIVE ME BRAINLIEST

One danger of excessive nitrogen levels in water is BLANK.

Answers

Answer:

light

Explanation:

excessive nitrogen can harm water bodies excessive nitrogen can cause overstimulation of growth of aquatic plants and algae excessive growth of the organisms intern can clogged water intakes used to solve oxygen as they decompose and block light to deeper waters

Other Questions
PLEASE HELPPP 50 pts! Your friend Jasmina is excited that you took personal finance this semester and comes to you for investing advice. She tells you: "I'm totally new to investing. I kind of know what a stock and bond are but I don't really know which specific ones to invest in. I remember playing the stock market game in school so I know the way to invest is to select individual stocks to put your money in! But, I don't know WHERE I go to actually start investing! When I started my job, our HR department told me that they offer a 401(k) plan and do a dollar-for-dollar match up to 3%...although I don't know what any of that actually means. I've also heard a lot of crazy stories in the news about individual stock prices just plummeting because of an unforeseen event, and I'm super worried that I'll lose my money. What should I do? Where do I start?"In your response below, - Answer Jasmina's questions to make sure she gets the investing knowledge she's looking for - Clarify any misconceptions she has about investing - Identify what steps Jasmina can take to start investing. Make sure you explain why she should take these -steps and how they will set her up for success. - Identify steps she can take in the future once she's more comfortable with investing what is Jasmina's Saving & Investing Plan: Express 46,100,000 in scientific notation. why did bhanubhakta decide to translate the ramayana into the nepali language? Here is the header for a function named computeValue:void computeValue(int value)Which of the following is a valid call to the function?A) computeValue(10)B) computeValue(10);C) void computeValue(10);D) void computeValue(int x); plz help me asap will give brainliest Ancient Chinese civilizations thought they lived at the center of the world because _____. they had no knowledge of civilizations in India, Egypt, Greece, or Rome they called themselves the people of Middle Earth Chinas rivers allowed civilizations to spread along the Huang River destructive floods brought life and death to the people of China A business spent 84% of its budget to start a new project. What fraction of the budget was spent on the new project? (reduce if possible) someone can answer this?x + y + 2 and x - y - 1 The coordinate plane shows Line A B.What is the length of the line segment? How did the end of the French and Indian War lead to discontent among Britains 13 colonies?1- Britain forced colonists to settle the Northwest Territory to protect against American Indian attacks.2- Britain imposed taxes on the colonists to pay for the cost of the war.3- Different colonies wanted credit for military victories during the war.4- The destructiveness of the war left thousands of colonists dead and many colonial towns in ruins. Explain how to estimate the quotient using compatible numbers. 27 2/3 divided by 3 9/10 Grace solved the equation 122=58 122 = x - 58 . Her work is shown. What error did Grace make? Women were held in high regard & were respected on the same level as men in Ancient China. (true or false) Which expression is equivalent to 1/5 m - 20 ? A: 1/5 (m - 4)B: 1/5 ( m - 100)C: 5(m - 4)D: 5(m- 100) Which country acquired French Guiana? PortugalSpainFranceGreat Britain what is the passive voice of 'she pleases her mother'? what might happen is Reese materials are not properly manage "Where can you see a list of all the transactions that have been matched or added to a bank register via the bank feed?" mention in points the measures that you adopt to be prevented from social problems Because I have several track meets coming up, I have been trying to stay fit and trim. Surprisingly, I was even having a fairly easy time resisting candy barsand desserts-that is, until yesterday. That's when my mother came home with six containers of freshly picked blueberries from the farmer's market anddecided to use them to make blueberry pie. Needless to say, the smell of the pies baking caused me to hanker for a great big slice. My younger brother,knowing that I was trying to watch what I eat, was downright naughty. He said that he was going to have as much pie as he wanted and goaded me to dothe same. Fortunately, my mother overheard him trying to tempt me. She told us that blueberries have many health benefits and suggested that onereasonably sized piece of pie would be good for me. I really appreciated that advice and now see that it is possible to indulge myself without goingoverboardWhich of the following could be used to replace downright (line 4)?O predictablythoroughlybarelyunexpectedly Steam Workshop Downloader