How is energy related to the change of state represented
by the model?
Atoms gain energy as a solid changes to a gas.
Atoms gain energy as a liquid changes to a gas.
Atoms lose energy as a solid changes to a gas.
O Atoms lose energy as a liquid changes to a gas.

How Is Energy Related To The Change Of State Representedby The Model?Atoms Gain Energy As A Solid Changes

Answers

Answer 1

Answer:

Explanation:

Atoms lose energy as a gas changes to a solid. How is energy related to the change of state represented by the model? Atoms gain energy as a solid changes to a liquid. If atoms energy during a change of state, they are pulled together by attractive forces and become more organized.

Answer 2

Answer:

Atoms gain energy as a liquid changes to a gas.

Explanation:


Related Questions

What is a carbon producer

Answers

Answer:

There are many many things in the world that produces Carbon. The largest source of greenhouse gas emissions from human activities in the United States is from burning fossil fuels for electricity, heat, and transportation. All of these produce Carbon into the atmosphere and warm the planet

Please put the following in order from Least Inclusive to MOST inclusive...

Organs Molecules Organ Systems
Organism Cells Tissue

A) Organism -> Organ Systems -> Organs -> Tissue -> Cells -> Molecules
B)Atoms -> Cells -> Molecules -> Organs-> Organ Systems -> Organism
C) Molecules -> Cells -> Tissue -> Organs -> Organ Systems -> Organism
D) Cells -> Organism-> Tissue -> Organ Systems -> Molecules -> Organs

Answers

Definitely C. A has it reversed, B includes atoms and puts molecules after cells, and D puts organisms right after cells

which of the following statements are true?
A. Flavr Savr tomatoes are still commercially successful.
B. A large percentage of US crops are currently genetically engineered.
C. Glyphosate kills all plant life, even genetically altered plants.
D. None of these are true

Answers

B! we had to alter them to our preferred taste and nutrients

What does “denature” mean in terms of protein structure?

Answers

Explanation:

Denaturation, in biology, process modifying the molecular structure of a protein. Denaturation involves the breaking of many of the weak linkages, or bonds (e.g., hydrogen bonds), within a protein molecule that are responsible for the highly ordered structure of the protein in its natural (native) state.

what is human intercose

practical of human intercose​

Answers

Answer:

Sexual intercourse, also called coitus or copulation, reproductive act in which the male reproductive organ (in humans and other higher animals)

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC


Highlighted letters are: ATACTACC

Answers

Answer:

1 and 5

Explanation:

https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question

Answer:

1.ATTAGC(ATACTAC)GGGC

5. ATGAATGC(ATACTACC)GGGC

Explain the law's of segregation and independent assortment.

Answers

Answer:

The law of segregation states that the two alleles of a single trait will separate randomly, meaning that there is a 50% either allele will end up in either gamete. This has to do with 1 gene. The law of independent assortment states that the allele of one gene separates independently of an allele of another gene.

Explanation:

I know it late but can u plz mark me brainliest?

What’s the answer ????????

Answers

it’s d
i looked it up and it’s the exact same:)

Answer:

D: Electrons are transferred from one atom to another.

Explanation:

Protons are not involved in the covalency, and C, electrons are shared between two atoms, is the definition of a covalent bond, such as water. Ionic bonds form when two atoms, share (transfer) electrons to one another in order to fill the outer electron ring.

Hope this helps!

which statement best describes the forces in the picture?
a. The applied force in the force of friction are balanced.
b. all four forces are the same size.
c. all four forces are acting in the same direction.
d. The applied force in the force of friction are unbalanced.​

Answers

Answer: Its A.

Explanation:

None

The applied force and the force of friction are balanced in the picture because of which the person is standing still. Therefore option (A) is correct.

What is force?

A change in the force that is applied to an item with mass will cause that thing to move at a different speed. A body's state of rest or motion can be altered by the application of an external agent known as force. It is significant in both magnitude and direction.

The term "frictional force" refers to the force that is produced when two surfaces come into contact with one another and then slide against one another. A few factors that affect the force of friction are as follows: These forces are primarily influenced by the surface texture as well as the amount of force that is drawing them closer together.

Learn more about force, here:

https://brainly.com/question/13014979

#SPJ5

Which of the following is an example of a complex machine?
1. Pulley
2. Wedge
3. Scissors
4. Incline

Answers

3- Scissors are an example of a complex machine.

Answer:

A :3

Explanation:

Just did acceleratted ed. Hope this helps!

NEED ASAP


Which quality would make the question "What will make cows produce more milk?" a good scientific question for a
biologist to investigate?
A) It is about living things and is testable.
B) It will help consumers save money.
C) It will lead to new technology to gather milk.
D) It is a question that can have many answers.

Answers

Answer:

D

Explanation:

The scientist could find new tech, which could lead to lower prices, also, it is about living things and testable, so it would be many answers.

Where is the error in the diagram?



DNA is copied during the shortest stage.


The cytoplasm divides during the longest stage.

The nucleus divides in the stage before the cytoplasm divides.

Both the nucleus and the cytoplasm divide in the same stage.

Answers

Answer:

But where is your diagram

Answer:

C

Explanation:

2. Describe a situation in which unbalanced forces are acting on an object. What is the net force
on the object, and how does the net force change the motion of the object?

Answers

Answer:

The force is by putting the two same objects on both sides and the motion is the scale

The force is by putting the two same objects on both sides and the motion is the scale.

What do you mean by force?

In physics, a force is an influence that can change the motion of an object. A force can cause an object with mass to change its velocity, i.e., to accelerate. Force can also be described intuitively as a push or a pull.

The normal force acts in a direction normal to the surface interaction between objects. Friction is a force that opposes motion on surfaces. Other examples of non-fundamental forces include the elastic force, tension.

Force is the fundamental result of an interaction between two objects, while power is an expression of energy consumed over time (work), of which force is an element.

Learn more about force:

https://brainly.com/question/13191643

#SPJ2

2. What is the name of the process of gathering evidence called? *
1 point
the Experimental Process
the Scientific Proof
the Scientific Experiment
the Scientific Method

Answers

Answer:

the answer is d scientific method

Answer:d the scientific method

Explanation:

This is the science of correct reasoning. The basic components are statements that can be true or false, but never both.​

Answers

Answer:

The basic components are statements that can be true or false, but never both. Magnetic Resonance Imaging This is a non-invasive body imaging procedure that uses powerful magnets and radio waves to construct pictures of the internal structures of the body.

Explanation:

PLEASE HELP ME I DONT KNOW THE ANSWER!!!!!

Answers

Answer: I think the answer is ( d) because the two tails are together to get stuck in the membrane as the picture shows

Explanation:

help please n thx <3

Answers

Answer:

The answer is The cell that contains the nucleus.

Question 6 of 20
A girl swings a yo-yo around in circles. How can she increase the total energy
of this system?
O
A. Reverse the direction of the swing,
O
B. Stand on a table while swinging the yo-yo.
C. Sit on the ground while swinging the yo-yo.
о
D. Swing the yo-yo at a lower speed,
SUBMIT

Answers

Answer:

it's B

Explanation:

A girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.

What is Yo-yo?

Yo-yo may be defined as a type of toy that consists of a pair of joined discs with a deep furrow between them in which thread is attached and wound.

By reversing the direction of the swing, swinging the yo-yo at a lower speed, and sitting on the ground while swinging the yo-yo decrease the total energy of the system. This is because the system does not have the momentum that is required to increase its overall energy.

Therefore, a girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.

To learn more about Total energy of the system, refer to the link:

https://brainly.com/question/478253

#SPJ5

Which factor is different between the tundra biome and a tundra ecosystem?
A. Soil moisture
B. Climate
C. Size
D. Type of plants

Answers

Answer:

b it is the climate

Explanation:

B the climate

Answer  C.Size

Explanation:

the reason why it is not climate is because the climate is the same. So as the soil moisture. The tundra biome is a bigger size than the ecosystem. The order from largest to smallest level of organism: biosphere,biome,ecosystem,community, population, and last organism.

Which of the following correctly identifies the function of the cell membrane?
A
controls what enters and leaves the cell
B
produces protein and enzymes
C С
controls the cell function
D
stores genetic infromation for the cell

Answers

Answer:

a controls what enters and leaves the cell

Explanation:

What are the differences between the Big Bang Theory and the Steady State Theory?

Answers

Answer

One is a move and the other is a part of a state.

Explanation:

Answer:

The only difference, he explained, was that in the big bang scenario all the matter was created in one explosive beginning.

What is the use of tail in human sperm?​

Answers

It’s an adaptation that allows the sperm to travel to the egg more efficiently as the distance is long and most sperm do not make it to the egg so this increases the chance of fertilisation.

Explanation:

what is carrying capacity? what type of population growth does it affect?

Answers

Carrying capacity is referred to a population size of species in a particular habitat. In an ecosystem, the population of a species will increase till it reaches its carrying capacity. Then the population size remains relatively equal.

What are the types of carrying capacity?

Carrying capacity is the maximum limit till that the ecosystem can support the existence of the population.

There are four categories of carrying capacity, namely:

Physical.Ecological.Economic.Social.

A specific environment's carrying capacity is the maximum population size that it can support.

The carrying capacity modifies the growth rate by slowing it when resources become scarce and stopping growth once it is reached.

Thus, it can be concluded that the carrying capacity is the average population size of species in a particular habitat which slows and stops the growth rate on reaching it.

For more details regarding carrying capacity, visit:

https://brainly.com/question/2375972

#SPJ1

The process during which a preexisting cell splits to form two cells is called

Answers

Mitosis is the process of a pre existing cells dividing into two cells.

Which of the following is a term use to describe a mound, hill of ridge of wind-blown sand?
A.peak
B.hill
C.contour
D.dune​

Answers

The answer is D.dune

Choose one carbon sink and explain how the carbon gets out of it.

Answers

Answer::

Explanation:

Which accurately labels the cytoplasm?
w
Х
Y
Z

Answers

Answer:

Y is the answer

Explanation:

I am 100%sure that the answer is Y

At what temperatures can monarch fly?

Answers

Answer:55 degrees

Explanation:In order for an adult monarch to fly, temperatures need to be above 55 degrees Fahrenheit.

Answer:

Temperatures need to be above 55 degrees Fahrenheit.

Explanation:


What problems can pseudoscience cause for society?

Answers

Answer:

It is quite difficult to picture a pseudoscientist—really picture him or her over the course of a day, a year, or a whole career. What kind or research does he or she actually do, what differentiates him or her from a carpenter, or a historian, or a working scientist? In short, what do such people think they are up to?

… it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.

The answer might surprise you. When they find time after the obligation of supporting themselves, they read papers in specific areas, propose theories, gather data, write articles, and, maybe, publish them. What they imagine they are doing is, in a word, “science”. They might be wrong about that—many of us hold incorrect judgments about the true nature of our activities—but surely it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.

Which of the following events occurs the earliest during the process of photosynthesis?

Answers

Answer:

If you give me the choices to choose from I cna answer.

Explanation:

Other Questions
What can be inferred about the description of The Poets Cookshop? A group of seven golfers paid $345 to play a round of golf. Of the golfers, one is a member of the club and six are nonmembers. Another group of golfers consists of two members and twononmembers. They paid a total of $140. What is the cost for a member to play a round of golf, and what is the cost for a nonmember? Decide whether the sentence is correct or incorrect as written.Ana est comiendo pizza.correctincorrect Geometry Help Please!! write a 150 words text about your impressions on a trip to a place you didn't know. Please help!!! Cold-winter survival experts do not recommend eating snow for hydration. One reason for this is the energy it takes to increase temperature of the snow, melt it, and then increase the temperature of the resulting water to body temperature. Calculate the total amount of heat to convert 2.000 kg of snow at -15.00 0C to liquid water at 38.00 0C.POTENTIALLY HELPFUL INFORMATION:The heat of fusion for water is 1.44 kcal/mol.The specific heat capacity of solid water is 0.488 cal/g0C.The specific heat capacity of liquid water is 1.00 cal/g0C.The freezing point of water is 00C (also known as melting point). PLEASE HELP! I dont understand how to do it :( Help please!!!! there is one more after this. what is this I need help4(8k+5)5(9k+4) In which sentence in the comma in the correct place?O No one likes to fail, but it is important not to give up.O Everyone can improve their mindset, and become more growth oriented with practice.O Many people have a fixed mindset, they can change their mindset with effort and practice.O People should focus on effort, it is through practice and hard work we have the greatest success. 9. The woods could conceal 1.Evaluate Sir Launcelot's behavior in the following excerpt from Le Morte d'Arthur. Whichaspect of the chivalric code does he uphold?"Sir, I see now that I might go in peace and good fellowship or otherwise fight to thedeath; but being the knight I am, I must tell you: I am Sir Launcelot du Lake..."O A generosityOB kindnessOC loyaltyOD honesty PLSSSS HELPPPPPP ME WITH THIS QUESTIONExplain the relationship between DNA structure and protein function? What is the ScientificMethod? Work out this problem: 2x + 3x -12x Show you work Which of the following describes a reason that colonial New England tended to have only small family farms? Add 38 and 29, then multiply by 2. What is the solition of 8 +a = 13? 1/6 of the fish in Nolan's fish tank are guppies. 2/3 of the guppies are red. What fraction of the fish in Nolan's tank are red guppies? a car is driven 1.5 kilometers west in 2 minutes. what is the velocity in m/s? Steam Workshop Downloader