Hello! I Need help with this. Please Help Make Sure you explain your answer i will be marking brainliest to the first person who has the right answer.....:D

Hello! I Need Help With This. Please Help Make Sure You Explain Your Answer I Will Be Marking Brainliest

Answers

Answer 1

Answer:

D

I dont really know how to explain it


Related Questions

Drop a paper, a piece of thermopol, and a piece of plastic from a height of 10-15 feet. Note the time for each object to hit the ground. Why does the paper take more time than thermopol and thermopol more than the plastic piece? Make the paper to fell down in such a way that it should hit the ground before all of them. How did it happen? Explain.

Answers

It took the paper longer because is has a lot of surface area that air can resist to and push up, making it float slowly to the floor rather then drop quickly. The piece of plastic is also more aerodynamic than the piece of paper because the air wont have as much surface area to resist to.

We folded it into a paper airplane. We did this so that it will be more aerodynamic.

Correct me if I’m wrong.



It took the paper longer as it has quite a few surface places that air can withstand and push up, making it glide slowly to the ground rather than drop fast. The piece of plastic is likewise extra aerodynamic than the piece of paper because the air won't have as an awful lot of floor regions to face up to.

What is aerodynamic in simple terms?

Aerodynamics is the way air actions around matters. The guidelines of aerodynamics give an explanation for how an aircraft is capable of fly. whatever that movements through air reacts to aerodynamics. A rocket blasting off the launch pad and a kite within the sky react to aerodynamics. Aerodynamics even acts on vehicles, considering that air flows around motors.

What is an aerodynamic example?

Aerodynamics is the way air moves around matters. given that air is all around us, there are many examples of aerodynamic technology other than for aircraft. take a look at golf balls for instance. golfing balls have their unique shape with loads of dimples on them to improve their aerodynamics and create more lift.

Learn more about Aerodynamics at https://brainly.com/question/4702501

#SPJ2

Place the answer below for the Deck Toys completion (two words)
If you do K12, you might know this

Answers

Answer:

What are the word options?

Explanation:

2. A unique characteristic of the banyan tree is that roots grow down from its
branches into the ground. The tree can appear to have several trunks. What
advantage does this root characteristic give the banyan tree over other trees?
A. The roots provide shelter for ground-dwelling animals, which carry nutrients
to the tree.
B. The banyan can grow near the equator, because aboveground roots are
more protected from the sun.
C. The banyan can only grow in humid climates, because aboveground roots
are more likely to dry out and die during droughts.
D. The banyan can grow in areas prone to hurricanes and typhoons because
the roots make the tree more stable in high winds.

Answers

Answer:

D. The banyan can grow in areas prone to hurricanes and typhoons because

the roots make the tree more stable in high winds.

Explanation:

According to this question, banyan tree posseses a unique characteristic in which roots grow down from its branches into the ground making the tree appear to have several trunks. This type of root is called STILT OR PROP roots.

The major function of this stilt roots is to provide additional support for the plant during adverse conditions. Hence, a major advantage that this root characteristic give the banyan tree over other trees is that it confers resilience upon the banyan tree, making it able to grow in areas prone to hurricanes and typhoons because the roots make the tree more stable in high winds.

Which phrase is appropriate for an advertisement for a health service?
"new discovery"
"FDA-approved''
"amazing results"
"European"

Answers

The answer would be amazing results

Answer:it’s FDA-approved

Explanation:

Don’t do amazing results it’s wrong I took the test

What is the orgenlle that takes place in photosynthesis

Answers

Answer:

chloroplast

Explanation:

Location X is next to Location Y and they are both much colder than Location Z. Which statement is most likely true? a Locations X and Z are at the poles. b Locations X and Y are at the poles. c Locations X and Z are at the equator. d Locations X and Y are at the equator. WILL MARK BRAINLIEST

Answers

B locations X and Y are at the poles

1. Blood flowing through the aorta is distributed to all parts of
the body, except the:
A. lungs.
B. small intestine.
C. heart.
D. brain.​

Answers

Answer:

I think d . brain must be the ans

What are some common characteristics that infectious agents like viruses, bacteria, fungi and parasites have in common? What are some differences?

Answers

Bacteria. These one-cell organisms are responsible for illnesses such as strep throat, urinary tract infections and tuberculosis. Viruses. Even smaller than bacteria, viruses cause a multitude of diseases ranging from the common cold to AIDS. (Here is some that I found.)

Pea plants can have alleles for being tall or for being short. A pea plant has one allele for being tall, and one allele for being short. When it grows, it ends up being a tall plant.

because of this what do we know is true about pea plant alleles?

A. being short is a dominant allele

B. All pea plants must be short

C. All pea plants must be
tall

D. Being tall as the dominant allele

Answers

Answer:

D

Explanation:

the dominant traits tends to be the one shown

Hibernation is an example  of A physical or structural adaptation .
True or false

Answers

False , only camouflage is a physical adaptation

Answer:

yea false

Explanation:

What roles do humans play in the carbon cycle?

Answers

Answer:

Humans affect the carbon cycle by burning fossil fuels and cutting down trees. Car exhausts and factory emissions produce a lot more CO2 in the atmosphere!

Explanation:

HOPE THIS HELPS:)

URGENT! HIGH POINTS
Match the following. Each word should be used only one time.
Colossians, deductive, defined, inductive, observations, Romans.


Science deals with __________________ of the physical world.

___________________ reasoning is the process of applying a rule.

___________________ reasoning starts with facts and works toward general conclusions. It is the process of finding a rule.

The statement “2+2=4” can be classified as a _________________ truth.

Christians should try hard to understand science, so that they are not deceived by hollow and deceptive philosophies (__________________ 2:8)

We can improve our relationship with God by studying His creation (____________1:20).

Answers

Answer:

A  Observations  B Deductive  C Inductive  D: Defined  E Colossians  F Romans

Explanation:

What is the carrying capacity (approx)?

Answers

Answer:

ecological terms, carrying capacity is defined as the maximum number of a species that can sustainably live in a given area.

In this diagram below , which of the stomach tissues would be muscular tissues ?


- tissue 1 : forms the outer lining of the stomach


-tissue 2 : produces enzymes which are secreted into the stomach cavity


- tissue 3 : cells in this tissue contract to churn the contents of the stomach


In a numeric number

Answers

Tissue 1 which forms the outer lining of the stomach would be the muscular tissues.

What is Muscularis mucosa?

This is referred to as the outermost layer of the mucosa and comprises of elastic fibers and smooth muscle cells.

The muscular tissue is therefore tissue 1 as a result of its location and function in the body.

Read more about Muscular tissues here https://brainly.com/question/2648088

#SPJ1  

NEED HELP VERY SIMPLE WILL MARK BRAINLIEST THANKS

Answers

Answer:

The organism

Explanation:

Answer:

last one and the second

Explanation:

What are 2 things to all cells have?

Answers

Answer:

All cells have CYTOPLASM and DNA.

Explanation:

my answer got deleted.

what properties of carbon explain carban's ability to form different large and complex structure?​

Answers

Sick icijdnxn I. N I I j. Snap

What happens when an organism is eaten? A. All of its energy is returned to producers. B. All of its energy is gone when it dies and cannot be reclaimed by the ecosystem. C. A small portion of its energy is absorbed by the consumer, the rest is transformed into heat or waste. D. All of its energy is absorbed by the consumer.

Answers

Answer:

The higher organisms eat the lower organisms, break down their matter and rearrange the molecules to make their own matter. When any organism dies, the remains are broken down and put back into the cycle as inorganic molecules. Each of these organisms eat organic matter to produce energy and small pieces of matter.


3. The diagram to the right shows a flower.
Which parts of the flower are male reproductive
structures?
A. parts A and B
B. parts C and D
C. parts E and F
D. parts D, E, and F

Answers

Answer:

A. parts A and B

Explanation:

A is the filament and B is the anther

PLEASE HELP ME NOW!!!!!!!!!!!
(02.03 HC)
Examine the layers of rock. Identify and explain which layer contains the youngest fossils. (3 points)

Answers

Answer:

A

Explanation: A is the youngest bestie <3333

Answer:

A

Explanation:

Because it is at the top

when a chicken with black feathers mates with a chicken with white feathers, their offspring may be a speckled hen. Half of a speckled hen's feathers are black and the other half are white. This is an example of:

A. multiple alleles

B. simple dominance

C. Codominance

D. incomplete dominance

Answers

i’m pretty sure it’s C. Codominance

Answer:

codominance

Explanation:

What is the function of epithelial cells?

Answers

Answer:

Pretty much everything that goes on inside ur body

Explanation:

Epithelial tissues are widespread throughout the body. They form the covering of all body surfaces, line body cavities and hollow organs, and are the major tissue in glands. They perform a variety of functions that include protection, secretion, absorption, excretion, filtration, diffusion, and sensory reception.

can anyone help me with this question? whoever answers first gets brainliest!

Answers

Answer:

A is the most likely

Explanation:

Will give brainliest to whoever gets it right at the end of my exam :))

Answers

Answer:

#3

Explanation:

what is the name of the process where plants water from their leaves?

Answers

Answer:

Transpiration

Explanation:

Transpiration That’s that

Why are cells so small?

Answers

Answer:

Why are cells small? because they can absorb nutrients much more efficiently. Because they are smaller they can efficiently absorb enough food. When a cell doubles in size the volume increases much more then the surface area, which is why large cells cannot receive enough food efficiently for their volume.

Hope this helped :)

Why does oxygen from our lungs diffuse into the bloodstream?

Answers

Answer:

so we can breath duh

Explanation:

Which pair of objects has the largest gravitational force?
a- car and bowling ball
b- marble and baseball
c- There is no gravitational force between any of these pairs of objects.
d-marble and can

Answers

Answer:a

Explanation: they are bigger they take up more space and heavier so the pull of gravity is stronger because of that

Who coined the word 'antibiotic'?

Answers

Answer:

Selman Waksman, the microbiologist who discovered streptomycin, first used the word "antibiotic" in the medical sense in 1943. Science historian Howard Markel talks about how it was actually a naval officer who first coined "antibiotic" in 1860, to describe an opposition to the belief in life beyond Earth.

If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?

Answers

UACCGCUCCGCCGCUCGACAAUACC
Other Questions
Jefferson and Madison opposed the formation of __ Read the excerpt from an 1810 speech by Tecumseh.You wish to prevent the Indians from doing as we wish them, to unite and let them consider their lands as the common property of the whole. You take the tribes aside and advise them not to come into this measure. . . . You want by your distinctions of Indian tribes, in allotting to each a particular, to make them war with each other. You never see an Indian endeavor to make the white people do this. You are continually driving the red people, when at last you will drive them onto the great lake, where they can neither stand nor work.Based on the excerpt, which was an effect of Tecumsehs advocacy for American Indians?the unification of American Indiansthe Battle of Tippecanoethe War of 1812the Indiana Peace Treaty What is the probability of getting exactly 2 heads when flipping three fair coins? x + y = -3y= 2Solve How did Iran change under Ayatollah Khomeini?Iran became more Westernized.Free speech was no longer limited.Religious leaders created official policy.Universities and other institutions opened. Give the uses of Words mail merge. When two countries sign a free trade agreement, they are agreeing to __________. A. reduce import and export barriers B. create new trade quotas C. reduce the volume of trade D. create protectionist policies Please select the best answer from the choices provided A B C D Which eukaryotic cell organelle contains genetic information and controls most cellactivities?O cell membraneO vacuoleO nucleuschloroplast Malcolm's boss is mad at him because he puts 4 meatballs in everysandwich instead of 2. How many extra meatballs does Malcolm put in eachsandwich?A. Multiply 4 by 2B. Add 4 to 2C. Divide 4 by 2D. Subtract 2 from 4 The cash basis of accounting is acceptable primarily in enterprises that do not have substantial credit transactions or inventories.a) trueb) false Which of the following domains include prokaryotic organisms?A. Archaea onlyB. Eukarya onlyC. Archaea and BacteriaD. Bacteria only Which statement about carcinogens is TRUE? *1)asbestos and tobacco smoke are known carcinogens2)carcinogens are unavoidable3)carcinogens can be inherited4)cells divide more slowly after being exposed to a carcinogen You are suddenly given a very large (1000 ) number of old desktop computers with old CRT monitors. What could you do with them Will Give Brainliest!! Give an example of biased news or a journalist slanting the news Electronic configuration of first 20 elements Plz complete all Please help!!!! Will give brainlist What is the angle made by two parallel lines im too tired for this please help me. Perform the following calculations and report each answer with the correct number of significant figures.a. 628 342 b. 5.45 2.3 c. 28.0/13.483 d. 14.98 + 27,340 + 84.7593 Steam Workshop Downloader