Drag each tile to the correct location.
Match each characteristic to the type of protist it describes.

Drag Each Tile To The Correct Location.Match Each Characteristic To The Type Of Protist It Describes.

Answers

Answer 1

Answer:

shows absuce of cell wall though chloroplasts may be present -plant like

slime mold belongs to this cateroy-fungus like

feeds on decaying matter-fungus like

presence of flagella-fungus like

Explanation:


Related Questions

12. Which type of erosion forms limestone caves?
A. wind erosion
B. stream erosjon
C. groundwater erosion

Answers

Answer:

c. groundwater erosion

Answer:

Hello There!!

Explanation:

I believe the answer is C. groundwater erosion.

hope this helps,have a great day!!

~Pinky~

What would the genotype be for an orange kitty

Answers

Answer:

DNA

Explanation:

What happens at the end of the lytic cycle 

Answers

The formation of new viruses.
formation of new viruses

What is the DNA test examining specifically?

It is comparing the protein enzymes.
It is looking for matching patterns of alleles.
It is trying to find a mutation.
It is examining the lipid level of the cells.

Answers

Answer:

it is examining the lipid level of the cells

Explanation:

The general procedure includes: 1) the isolation of the DNA from an evidence sample containing DNA of unknown origin, and generally at a later time, the isolation of DNA from a sample (e.g., blood) from a known individual; 2) the processing of the DNA so that test results may be obtained; 3) the determination of the ...

Describe the structure of a fibrous joint and give an example of where this occurs in the body.

Answers

Answer: The structure of fibrous joint includes two bones who are fused with one another and no possible movement between them.

Explanation: For example, the joint between two bones of skull. The frontal bone and the temporal bone of the skull are fused with one another and there is no movement between the two bones. Where the bones are fused together a fissure is formed , it is like a line but little deep on the surface to show that there is a fusion . This type of joint is mostly present between the bones where there is no movement like in the skull , between the vertebrae , between the ribs and sternum.

Smooth
Smooth
O
Smooth
A.
Smooth
o
Smooth
X
X
Wrinkled
It is true only in the plant world.
Smooth
Smooth
Based on the information above, what would a geneticist say about the example of the
pea plants?
Smooth
Wrinkled
B.
It is based purely on chance.
C. It has no relationship to human transmission of traits.
D. It helps show transmission of traits from parents to offspring.
E. It is too dated to have application in today's world.

Answers

Mendel's tests on the pea plant are still relevant today since they demonstrate how traits are passed down through generations, hence option D is correct.

What are pea plant traits?

The pea experiment is frequently used in classrooms because peas have distinguishable qualities and it is relatively straightforward to analyze how these traits are inherited.

When a person possesses a dominant characteristic and is heterozygous for that trait, the descendants of that person might also possess a recessive trait.

Therefore, It helps show the transmission of traits from parents to offspring.

Learn more about traits, here:

https://brainly.com/question/27812255

#SPJ1

Experts and above ONLY
To answer this u have to be expert, ace or genius level

25 PTS PLEASE HELP QUICK
(not related to the question but please add thx i want friends)
OK THX THE QUESTION IS BELOW

Answers

Answer:

Answers are in the image

define agriculture plz​

Answers

Answer:

practice of farming, including cultivation of the soil for the growing of crops and the rearing of animals to provide food, wool, and other products.

Explanation:

Answer:

Hello There!!

Explanation:

Agriculture is the art, the science and the practice of cultivating the soil, growing crops and raising livestocks.

hope this helps,have a great day!!

~Pinky~

PLZ HURRY I ONLY GOT ABOUT 10 MINS LEFT

Answers

Answer:

b

Explanation:

i had this same quiz when i was younger

The answer is B: tectonic movement.

The shifting of tectonic plates is what is responsible for the movement of continents over millions of years.

Which process is responsible for causing this column of rock to form?
A. crystallization
B. deposition
C. sedimentation
D. weathering

Answers

I believe the answer is crystallization

Answer:

i believe it would be a because of stalagtites and stalagmites but i'm not 00% sure

Explanation:


Which current has a warming effect on the climate of the southeast coast of Africa?

Answers

Answer:

Agulhas Current

Explanation:

The Agulhas Current transports warm water from the Indian Ocean southwards along the South African coast.

Answer:

Agulhas Current

Explanation:

Other persons explanation

Which option is a renewable source of energy?
a.Petroleum
B. Wind
C. Nuclear power
D. Coal

Answers

Answer:

B. Wind

Explanation:

Because nature constantly replenishes the wind, we can continue to harness its power without worrying about running out of it.

the energy role responsible for capturing the energy from the sun and turning it into food is a

A. producer

B. Consumer

C. Decomposer

Answers

Answer:

A. Producer

Explanation:

The primary source of energy for almost every ecosystem on Earth is the sun. Primary producers use energy from the sun to produce their own food

Answer:

Hi, there the answer is A. producer

Explanation:

All food chains start with energy from the sun. This energy is captured by plants. Thus the living part of a food chain always starts with plant life and ends with an animal. Plants are called producers because they are able to use light energy from the sun to produce food (sugar) from carbon dioxide and water.

observe the cartoon on the next page.Identify each simple machine represented in the machine.your choices will be:lever,inclined plane,pulley,wedge,screw,,wheel and axel,and pendulum.(not really a simple machine,but will be ok in this worksheet)

Answers

Answer:

Hii could u please show me the cartoon??

: )

Explanation:

A small proportion of humans have resistance to strains of HIV, the virus that causes AIDS. Their immunity is caused by a deletion in gene CCR5, a co-receptor on white blood cells needed for HIV infection. The proportion of people with resistance (genotype aa) to HIV is approximately 8%. If these alleles are in Hardy Weinberg equilibrium, what proportion of people are carriers for the HIV resistant allele?

Answers

Answer:

The correct answer is "40.6%". A further explanation is provided below.

Explanation:

The given values are:

The proportion of people with resistance is,

aa = 8%

or,

    = 0.08 (q²)

= 0.08

q   = √0.08

    = 0.28284

Now,

⇒ [tex]p+q=1[/tex]

⇒       [tex]p=1-q[/tex]

             [tex]=1-0.28284[/tex]

             [tex]=0.717157[/tex]

hence,

For the HIV resistant allele, the proportion of people will be:

= [tex]Aa[/tex]

= [tex]2pq[/tex]

On substituting the values, we get

= [tex]2\times 0.71715\times 0.28284[/tex]

= [tex]0.4056[/tex]

= [tex]40.6[/tex] (%)

The proportion of the population with the carrier of HIV-resistant allele is 40.56%.

What is Hardy Weinberg equilibrium?

Hardy Weinberg equilibrium is the relationship between the variation from one generation to the next. The equation for the relationship can be given as:

[tex]p^2+2pq+q^2=1[/tex]

Where the proportion of dominant alleles is p².

The proportion of recessive alleles is .

The proportion with the caries are 2pq.

The given recessive allele proportion in the population is 0.08. The proportion of dominant alleles can be given as:

[tex]q^2=0.08\\q=0.2828[/tex]

The dominant alleles can be given as:

[tex]p+q=1\\p+0.28284=1\\p=0.717157[/tex]

The carriers in the population can be given as:

[tex]\text{Carriers}=2pq\\\text{Carriers}=2\;\times\;0.717157\;\times\;0.2828\\\text{Carriers}=0.4056\\\text{Carriers}=40.56\%[/tex]

Thus, the carriers for the HIV gene in the population are 40.56%.

Learn more about Hardy Weinberg equilibrium, here:

https://brainly.com/question/3406634

All living organisms _______
A. Photosynthesize
B. Respire
C. Move
D. Feed
E. Transpire

Answers

Answer:

B. Respire

hope it helps ... 【◆◆】

The answer is a and I am leaning about it too

Describe how you would identify mutations that are dominant. Describe how you would identify mutations that are dominant. To identify dominant mutations, breed the mutant individual to a mutant individual. Dominant mutations will be visible in the F1 generation. To identify dominant mutations, breed the wild-type individual to a wild-type individual. Dominant mutations will be visible in the F1 generation. To identify dominant mutations, breed the mutant individual to a mutant individual. Dominant mutations will be visible in the F2 generation. To identify dominant mutations, breed the mutant individual to a wild-type individual. Dominant mutations will be visible in the F2 generation. To identify dominant mutations, breed the mutant individual to a wild-type individual. Dominant mutations will be visible in the F1 generation.

Answers

Answer:

To identify dominant mutations, breed the mutant individual to a wild-type individual. Dominant mutations will be visible in the F1 generation.

Explanation:

Due to technical problems, you will find the complete explanation in the attached files

Number of matings of roan-coated cows and roan coated bulls resulted in the following

Answers

When red cattle breed with red cattle, the resultant offspring show both red and white fur, resulting in a mixed coat pattern called "roan."

What is a roan bull?

The roan pattern, normally in Shorthorn cattle, is inherited as a heterozygous genotype. Roaming is usually the intermixing of two dissimilar colored hairs - black and white make a blue roan while red and white make a red roan.

The roan coat color in livestock species is distinguished by a mixture of white and tint hair in cattle, If it is a breed that has the roan color pattern, like a Shorthorn, then yes it can be pure-blooded. Or it can be a cross-breed with the roan color pattern. Roan is a color, not a breed.

So we can conclude that Roan" mentions a horse coat color pattern characterized by a mixture of colors.

Learn more about Roan here: https://brainly.com/question/8167873

#SPJ1

Question attached with image

Answers

One of the genetic diseases known as sickle cell disease is sickle cell anemia. Red blood cells, which deliver oxygen to every region of the body, are affected in terms of structure.

What is Sickle cell anemia?

Red blood cells can flow through blood veins with ease. Red blood cells with sickle or crescent shapes are characteristic of sickle cell anemia.

Additionally, these sickle cells develop a hard and sticky coating that can hinder or delay blood flow.

Most persons with sickle cell anemia are incurable. Treatments can reduce suffering and aid in avoiding disease-related consequences.

Therefore, One of the genetic diseases known as sickle cell disease is sickle cell anemia. Red blood cells, which deliver oxygen to every region of the body, are affected in terms of structure.

To learn more about Sickle cell anemia, refer to the link:

https://brainly.com/question/876359

#SPJ1

Does every gene combination show up in the offspring?

Answers

Answer:

Answer!

Explanation:

Okay so, genes come in different varieties; which are called allele. somatic cells contain two alleles for every gene, with one allele provided by each parent of an organism. BUT, an allele that is hidden, or not expressed by an organism, can still be passed on to that organism's offspring and expressed in a later generation.

During meiosis I, chromosomal pairs randomly align along the metaphase plate. Each chromosome pair member carries one allele for each gene. Every gene combination shows up in the offspring.

Chance determines which of the 23 homologous pairs of both parents' chromosomes are inherited. The possible combinations of 23 chromosomal pairs total 8,324,608. As a result, the chromosomal combinations of two gametes are almost never identical.

Actually, each parent has two distinct gene pools. Additionally, only half of each parent's DNA is passed on to their offspring. and that the randomness of the portion that is passed down. All of these factors work together to guarantee that every child has a distinct collection of genes.

To know more about gene, visit;

https://brainly.com/question/31121266

#SPJ6

pls help me I am rlly confused

Answers

All of an organism's characteristics are inheritable which evolves over millions of years. An example of this is the modern day horse's foot.

What is Evolution?

This is referred to as the change in the heritable characteristics of biological populations over successive generations.

All an organism's characteristics can be inherited and evolves over a period of time as a result of the changing environmental conditions which helps them to adjust thereby increasing their chances of survival hence preventing extinction of species.

For example, over millions of years of evolution, many horses lost their side toes and developed a single hoof as a result of them needing to move at faster speeds to evade predators.

Read more about Evolution here https://brainly.com/question/12271572

#SPJ1

Please help meeeee omgggg!!!

Answers

Answer:

Pollination

Explanation:

Bees and other pollinators drink nectar and get pollen on their feet and little pockets. When they go drink from another plant, the pollen falls on the reproductive organ and reproduction has begun.

Hope this helped :)

Answer:

The answer is A.

Explanation:

The answer is A. because for two pants to breed it depends on the pollen.

What are air masses, and how do they work? Don't copy and paste.

Answers

What are Air Masses:  They large volumes of air that have generally the same temperature and pressure.

How they work: One is heated by an electrical current, the other is not. As air flows across the heated wire, it cools down.

Example of an Air Mass: The air masses in and around North America include the continental arctic, maritime polar, maritime tropical, continental tropical, and continental polar air masses. Air is not the same everywhere.

Fact: Unstable air masses have different temperatures and pressures.

How they are formed: An air mass forms whenever the atmosphere remains in contact with a large, relatively uniform land or sea surface for a time sufficiently long to acquire the temperature and moisture properties of that surface.

*** The Earth's major air masses originate in polar or subtropical latitudes.

What percentage of the population can determine their blood type from
saliva, tears,sweat, or milk? (Numerical answers only) thanks

Answers

About 80% of the population can determine their blood type from saliva, tears, sweat or milk. These are known as secretors, and they refer to the fact that antigens present in the blood can also be found in bodily fluids like saliva.

What are antigens?

Your immune system uses antigens as markers to determine whether or not something in your body is hazardous. Viruses, bacteria, cancers, and healthy bodily cells all include antigens. Antigen testing is carried out to identify viral infections, keep an eye on specific illnesses, screen for them, and ascertain a donor's compatibility with a transplant.

What are secretors?

The term "secretor status" describes whether water-soluble ABO blood group antigens are present or absent in a person's body fluids, including saliva, tears, breast milk, urine, and semen. People are classified as secretors or non-secretors depending on whether they secrete certain antigens in their body fluids.

To know more about antigens, check out:

https://brainly.com/question/7597406

#SPJ1

Pleeeeeasssssee heeelp asap The image is attached

The box lists some characteristics of a plant that has adapted to conditions in Its environment. Grows in clusters and low to the ground Able to grow under a layer of snow Carries out photosynthesis at temperatures below freezing Flowers very quickly and briefly during Summer Produces small, moisture-retaining leaves To which type of environment is the plant best adapted? A. Desert Grassland Rainforest D. (ID Tundra​

No links i will report

Answers

The answer is B. Grassland

Which structure can be found in a eukaryotic cell but NOT in a prokaryotic cell?

A.
mitochondrion


B.
cytoplasm


C.
chromosome


D.
plasma membrane

Answers

Answer:

Plasma membrane

Explanation:

The correct answer is mitochondrion.

Intercalated disc between cardiac muscle cells serve to transfer

Answers

Answer:

Serve to transfer signals between cells.

Explanation:

Intercalated disc also called gap junctions are structural formations that are located between the myocardial cells of the heart. They help to bond or connect cardiac cells fibers together. They also help in cell to cell communications and propagate action potential. They serve to transfer signals between cells.

2. Which of the following is not true of protozoa?
© Lack cell wall
b) Produce no spore bearing structures
c) Comprise the microbial population known as phy
d) Form active feeding forms called trophozoites​

Answers

Answer:

c) Comprise the microbial population known as phy
the answer is C (:) !!


When blood passes through a capillary bed in the
it downloards O2 and uploads CO2.

Answers

Answer:

Exchange of gases takes place at alveoli sacs of lungs, which are equipped with capillary vessels or bed.

Explanation:

On inspiration or taking air through nostrils, surrounding air enters the lungs and it reaches air sacs or alveoli. Here, the outside air will have more amount of oxygen when compared with oxygen in blood at that site. Hemoglobin in the blood have high bonding capability to oxygen, so it captures oxygen and takes it to heart for pumping into other parts of the body. Likewise, the circulations continues from lungs to heart > hear to body parts > body parts to heart > heart to lungs for purification.

a change in position in relation to a reference point is:
a. acceleration
b. displacement
C. speed
d. velocity

Answers

Answer:

it would be b. displacement

An object is in motion if it changes position relative to a reference point. You assume that the reference point is stationary, or not moving. Frame of Reference Speed If you know the distance an object travels in a certain amount of time, you can calculate the speed of the object. Speed! Hope this helped
Other Questions
Cultural differences that might influence the guest service experience include all of the following except diet greetings humor marriage What was the Selective Service Act and how did it impact the war? When considering the various resources factors of production which of the following is most likely to represent capital? Find the area. The figure is not to scale You can NOT have an in group without having an out group True False 3 chairs and 4 tables cost rs 7540. if the price of a chair is 220 find the price of table?ans - 7120 two equivalent ratios for 17:5? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA The table below shows information about how many fans there were at twofootball matches in a local tournament.What is the difference between the number of away fans at the semi-final and atthe final?Semi-finalFinalTotal number of fans250400Ratio of home fansto away fans6:47:3 Follow the constitution and the law even if I disagree with it what power or duty is this listed on Nika rolls an 8-sided cube with faces numbered 1 through 8. Which of the following statements is true? P(even number) = P(odd number) = P(number less than 8) = 1P(the number 9) = 1 Why might Great Britain's colonies have contributed tothe start of Ine Industrial Revolutionin Great Britain? What is irony What are the 3 types of irony and examples of each? Which question is a statistical question?A. How tall is the oak tree?B. How much did the oak tree grow in one year?C. What are the heights of the oak trees in the schoolyard?D. What is the difference in height between the oak tree and the pine tree? HELP FOR MY FINAL PLEASE PLEASE In a random sample of 70 people, it was found that 44 of them were fans of the New York Yankees. What is the margin of error for the true proportion of all individuals who are fans of the New York Yankees? A. 0.0088 B. 0.058 C. 0.063 D. 0.116 E. 0.173 Which sentence is the most formal?A. Hi! Do you have any job openings at your work yet?O B. I would like to apply for the administrative position at yourcompany.C. I think it would be really fun to work at your company.D. Please hiring my person for the open position you got in yourestablishmentLIDT TCS the scrum team is using the KANBAN board to make work visually availible to all. What cannot be inferred from the board You can find Maya Angelou's many poetry volumes in most bookstores. What word or phrase is modified by the prepositional phrase in this sentence? What statements about prisms are always true if the top base is directly above the bottom base? Select all that apply. The lateral faces are rectangles. The bases are congruent. The bases can be any shape. The lateral faces are congruent.