Answer: yes because they need more energy
Explanation:eukaryotes are more complex than prokaryotes
One danger of excessive nitrogen levels in water is BLANK.
Answer:
light
Explanation:
excessive nitrogen can harm water bodies excessive nitrogen can cause overstimulation of growth of aquatic plants and algae excessive growth of the organisms intern can clogged water intakes used to solve oxygen as they decompose and block light to deeper waters
Which type of cell transport occurs when there are an abundance of oxygen molecules
in the bloodstream, and they pass directly through phospholipids of the cell membrane
to enter cells?
Answer:
Diffusion
Explanation:
hope this helps!
What is the function of cholesterol?
to keep the cell membrane from falling apart
to line the arteries of organisms
to store energy
to give us quick energy
Answer:
to store energy
Explanation:
Its main function is to maintain the integrity and fluidity of cell membranes and to serve as a precursor for the synthesis of substances that are vital for the organism including steroid hormones, bile acids, and vitamin D. Cholesterol is essential for making a number of critical hormones, including the stress hormone cortisol. Cholesterol is also used to make the sex hormones testosterone, progesterone, and estrogen. 2 The liver also uses cholesterol to make bile, a fluid that plays a vital role in the processing and digestion of fats.
What is the value of the expression 3 divided by 3/4
Answer:
4
Explanation:
If we have the expression, 3/3/4.
Then this is the same as 3 × 4/3
Which is the same as 12/3
Which is the same as 4
Hence the value of the expression 3/3/4 is 4
I NEED HELP
1. What are chromosomes?
2. What are the four phases of mitosis, in the correct order?
3. In what phase of mitosis are chromosomes moving toward opposite sides
of the cell?
4. Compare the two nuclei that form as a result of mitosis?
5. What is cytokinesis, and when does it occur?
Answer:
1. a chromosome is a dna strand that has genes
2. prophase, metaphase, anaphase, telophase
3. anaphase
4. the two nuclei are identical daughter cells and they have the same number of chromosomes
5. this is when the cell separates forming two new daughter cells and it occurs in the late telophase of mitosis.
sorry if this is wrong but this is how i learned it! hope it helps!
Explanation:
WILL GIVE BRAINLIEST!!!!!!!!!
In all living things, the presence of what structure supports the cell theory.
cell membrane
chloroplast
cell wall
vacuole
Answer:
chloroplast
Explanation:
Which of the following is NOT produced by
respiration
sugar
Ds ATP energy
carbon dioxide
water
Answer:
I think its water or sugar.
the process of which cells make proteins is called protein what?
this is a fill in the blank!
Answer:
protein biosynthesis
Explanation:
prove me wrong
Answer:
any of a class of nitrogenous organic compounds that consist of large molecules composed of one or more long chains of amino acids and are an essential part of all living organisms, especially as structural components of body tissues such as muscle, hair, collagen, etc.
Explanation:
What is a niche, and how does it relate to evolution?
Answer:
The evolution of species’ niches is a process that is fundamental to investigations in numerous fields of biology, including speciation, community assembly, and long-term regional and global diversification processes. It forms the nexus between ecological and evolutionary questions. Topics as diverse as ecological speciation, niche conservatism, species coexistence, and historical biogeography all rely on interpreting patterns and drivers of species’ niches through time and across landscapes. Despite this importance, a distinct research agenda concerning niche evolution as a discrete topic of inquiry has yet to emerge. Niche evolution is often considered as a sidebar or of secondary importance when addressing questions such as “how did two species diverge?” Basic questions such as “what is a niche,” “what is the biological basis of niche evolution,” “at what scale should we evaluate niche evolution,” and “how can we observe niche evolution at different timescales” have rarely been addressed directly, or not at all in some systems. However, various intellectual threads connecting these ideas are evident in a number of recent and historical publications, giving some semblance of form to a framework for interpreting and evaluating niche evolution, and outlining major areas for future research from an evolutionary perspective. There is a reverse perspective from the macroecological scale as well, with questions involving coexistence, distributions and ranges, food webs, and other organismal attributes
Explanation:
ye
Some descriptions, such as color and odor, involve using your _____.
volume
measurements
senses
mass
At the beginning of the film, director Ron Howard shows two contrasting scenes: The deaths of the Apollo 1 crew and a party celebrating the landing of Apollo 11 on the moon. How do these scenes foreshadow the rest of the movie?
Answer:
It foreshadows that the Apollo 11 made it to the moon, while Apollo 1 did not
Explanation:
Which combination of atoms will form a molecule, but
not a compound?
O W and X
O X and Y
O W and Z
O Y and Z
HELP PLZZZZ
Answer:
but you did not give z
Explanation:
what is z
In non-mendelian genetics, humans have 4 blood types in which A and B are codominant and o is recessive. I cross two parents with type AB blood. What is the percentage of children with type B blood?
A. 0%
B. 25%
C. 50%
D. 100%
Answer:
i think it may be 50 dont be mad if im wrong
Explanation:
recessive takes over from what i read i dont see any o so it can be half a half b so 50...
Which of these statements would be MOST important to include in an objective summary of the article?
A. The health triangle is a helpful tool for visualizing your total well-being.
B. Physical health represents your biological welfare and how to protect your body from illness or injury.
C. Consuming a well-balanced diet is one of the best ways to fuel your physical health.
D. You don't have to compete in Ultra-Marathons in order to reap the physical benefits of exercise.
Answer:
A
Explanation:
What term describes parts of the body that are made from different kinds of cell
Answer:
The term that describes the parts of the body with different kindsof cells is organs, which in turn are made up of different tissues.
Explanation:
The cell is the structural and functional unit of all living beings, with the capacity to multiply and unite to form tissues.
Each tissue is a differentiated or specialized structure, formed by groups of cells of the same type, such as muscle, nerve, connective, cartilage and bone tissue, among others.
The specialized tissues in turn form organs, with specific structures and functions, such as muscle, brain and nerves or bones and joints. For this reason, organs are different body parts, formed by different kinds of cells.
this is a cell not a plant, because the cell do not contain________
Answer:
Chloroplast.
Explanation:
This is what I believe it is since we're obviously talking about an animal cell and NOT a plant cell like it says. Animal cells do not contain chloroplast.
If this is the answer you're not looking for, let me know! Hope this helped! :)))
Please help me with this and answer correctly.
Brainliest will give!!
Answer:
Sorry can't help
Explanation:
PLEASE GIVE ME BRAINLIEST
I will mark brainest if you get it right
A photovoltaic cell captures ____ to be used for power.
A. Wind
B. Water
C. Coal
D. Sunlight
Answer:
D. Sunlight
Explanation:
Answer:
santa claus
Explanation:
plzzz help i willl give you a Brainliest if you get it correct
Most scientists come up with questions to investigate out of the blue.
1.true
2. false
Answer:
the correct answer is false.
Replication, Transcription, and Translation Chart
Please answer
DNA Replication:
1。Template Strand: Start with this nucleotide chain.
TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC
2。Complementary DNA Strand: Write directly below template strand.
Transcription:
3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).
Translation:
4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).
5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).
6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).
Answer:
jnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
Explanation:
The spinal cord relays messages between the body and the brain. These messages control body functions like movement, bladder and bowel control and breathing. Each vertebra has a pair of spinal nerves that receive messages from the body (sensory impulses) and send messages to the body (motor impulses). The spinal nerves are numbered 1 to 55 from the neck down. The first eight as seen here are the vertebrate and send messages to the back of the head, neck, shoulders, arms, hands and diaphragm. A) cervical B) lumbar C) sacral D) thoracic
As you observe an unknown cell under a microscope, you make the following observations..
Answer:
It is a plant cell that is being observed
Explanation:
With in the cell, there are chloroplasts that ONLY a plant cell has. It also has a cell wall which an animal cell does not, so it is clearly not an animal cell.
Why are elements called
the building blocks of matter?
A. They stack up nicely.
B. They make-up all matter.
C. They make-up most of the matter around us.
Answer:
B
Explanation:
Global Warming is not a thing!
Answer:
This is not an answer
Explanation:
You overhear your mom and dad talking about having a well installed in your yard. What advice can you offer them about determining the placement and potential effectiveness of the well? Think about what you know about how wells factor into the groundwater systems running below the surface of the Earth.
Answer:
Built well where water table present nearer to surface.
Explanation:
My advice for them about determining the placement and potential effectiveness of the well is that the well should be installed where the groundwater present nearer to the surface, the reason behind this advice is that minimum work and energy will be used for digging well. If the water table is present very deep, more work and energy will be utilized on the digging of the well. Those areas where more rainfall occurs, the depth of water table is less as compared to arid zones because due to more rainfall more water goes inside the soil and the water table rises.
A group of researchers wants to develop an experiment to determine whether a new drug effectively treats cancer. The researchers want to inject the drug in hamsters first to determine whether there are any potentially serious side effects.
Part A: What are some possible ethical issues with this type of testing?
Part B: While conducting the experiment, the researchers find cancer stops spreading, and they declare the new drug is responsible. Is this a good assumption? Explain.
Answer:
Part A: The animals are used for examining and determining the effect of a particular new drug for the treatment of the diseases and disorders before they are examined over humans. This practice is called as clinical trial.
The ethical issue associated with given type of testing is that animals have right to live and survive. They should not be subjected to the treatment where they experience harm or even death.
Part B: Those assigned to the control take a sugar pill. The only thing you want to vary across groups when you're conducting an experiment is the treatment. Since taking pills is a part of taking medication (the treatment), medical experiments often employ something called a placebo-controlled study where outcomes for those who are randomly assigned to take the medication are compared to outcomes for those who are randomly assigned to take a sugar pill. The sugar pill is expected to have no effect, so it serves as a useful baseline to compare the treatment to.
Answer:
The current code of ethics to be upheld in science experiments are as follows: the experiment must contain a clear scientific purpose, the animals must be housed and provided with care, the animals must be legally acquired, the least amount of suffering must be ensured, and the animals can only be used when it is entirely necessary.
In this paragraph, we can see the plan does not fit the code of ethics entirely- because this is a new drug, we can not be sure that this experiment will not be fatal for the animals, and that they will not suffer tremendously before passing on. The medicine should be tested first on a sample which is not living.
Explanation:
Why is sickle cell anemia so harmful to its carriers?
Answer: BECAUSE IT MAKES THE RED BLOOD CELLS SHRINK
Explanation:
Answer:
Sickle cell anemia is harmful to the body because it is enagering your spleen and with less healthy red blood cells circulating in the body, you can become chronically anemic.
Sickle cell anemia puts your body at more risk for infection.
Explanation:
In the water cycle, water returns to the ground as precipitation. How does phosphorus return to the soil in the phosphorus cycle?
A.
Phosphates found in soil dissolves in water.
B.
Phosphates are absorbed by the roots of plants.
C.
Animals eat the plants that absorbed the phosphates.
D.
Animals that ate the plants die and decompose.
Answer:
D
Explanation:
what are the two main organs involved in the respiratory system?
Answer: The respiratory system is the network of organs and tissues that help you breathe. It includes your airways, lungs, and blood vessels. The muscles that power your lungs are also part of the respiratory system.
Explanation: Your respiratory system is the network of organs and tissues that help you breathe. This system helps your body absorb oxygen from the air so your organs can work. It also cleans waste gases, such as carbon dioxide, from your blood. Common problems include allergies, diseases or infections.
What is the respiratory system?
The respiratory system is the network of organs and tissues that help you breathe. It includes your airways, lungs, and blood vessels. The muscles that power your lungs are also part of the respiratory system. These parts work together to move oxygen throughout the body and clean out waste gases like carbon dioxide.
Choose all the answers that apply.
Binary fission _____.
is the type of reproduction used by bacteria
occurs in organisms that do not have a membrane bound nucleus
is a type of sexual reproduction creates identical copies of the parent cell
is a type of asexual reproduction
Answer:
A, B, D
Explanation:
Binary fission occurs primarily in prokaryotes, but can occur in eukaryotes. It is used by bacteria and is asexual reproductio, not sexual.
Explanation:
occurs in organisms that do not have a membrane bound nucleus. Explanation: Binary fission is an asexual mode of reproduction. As it does not involve formation and fusion of gametes.