can you please answer these questions for me I really need help I am begging you

Can You Please Answer These Questions For Me I Really Need Help I Am Begging You
Can You Please Answer These Questions For Me I Really Need Help I Am Begging You

Answers

Answer 1

Answer:

1: 75%

2: 75%

3: 50%

4: 25%


Related Questions

Which of the following best describes Darwin's (and Wallace's) theory of evolution?

Question 1 options:

Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.


The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.


Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the island


The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection.

Answers

Answer:

4

Explanation:

The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection according to Darwin's (and Wallace's) theory of evolution.

Natural selectionNatural selection is the process through which populations of living organisms adapt and change.It is a key mechanism of evolution, the change in the heritable traits characteristic of a population over generations.In 1859, Charles Darwin set out his theory of evolution by natural selection as an explanation for adaptation and speciation.

Thus, we can conclude that The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection.

You can learn more about the natural selection here:

https://brainly.com/question/23929271

#SPJ2


BRAINIEST ANSWER!

HELP :))

Answers

Answer:

True

Explanation:

Don't know tell me if I'm wrong

Answer:

True

Explanation:

Actually it destroyed a LOT more than that...

Which type of bleed would typically be more urgent to treat—venous or arterial?

Answers

Answer:

Arterial bleeding is more dangerous than venous bleeding. The arteries carry blood from the body and back into the heart. If the arteries become damaged and start to bleed out, an individual can suffer loss of life within five minutes if the bleeding is severe and if no medical attention is received.

5. What does Grover give Percy?

Answers

Answer:

Explanation:

Grover gives Percy a present in a shoebox and  it's the horn that Percy snapped off of the head of the Minotaur.

Answered by the ONE & ONLY #QUEEN herself aka #DRIPPQUEENMO!!

HOPE THIS HELPED!!

Volume of the large cube is 7.506 x 10 mm. The volume of each small cube is 2.78 X 104 mm'. How many small cubes make up the large cube?

Answers

Answer:

27

Explanation:

B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?

Answers

Here's li[tex]^{}[/tex]nk to the answer:

bit.[tex]^{}[/tex]ly/3tZxaCQ

Why are archaea in a different domain from bacteria?
A. They are multicellular, but bacteria are unicellular.
B. They are thought to have separate paths of evolutionary
development
C. They are able to perform endosymbiosis, but bacteria are not.
D. They have no similar characteristics.

Answers

Answer:B

Explanation:

Archaea is in a different domain from bacteria because they are thought to have separate paths of evolutionary development. Therefore, the correct statement is option B.

What are the differences between archaea and bacteria domains?

Archaea and bacteria are both prokaryotic organisms, but archaea are more closely related to eukaryotes than bacteria. Archaea have unique  lipid membrane and cell wall components that are different in composition than those found in bacteria.

These differences suggest that archaea and bacteria evolved to have separate paths of evolutionary development early in the history of life on Earth and then classified into Archaea and Bacteria domains.

Based on the phylogenetic tree constructed by researchers, the tree has classified life into three domains which are Archaea, Bacteria, and Eukarya These domains are based on their fundamental genetic and biochemical differences.

Therefore, archaea and bacteria are in a different domain because they followed separate paths of evolutionary development.

Learn more about the archaea domain here:

https://brainly.com/question/31089143

#SPJ5

What helps meteorologists to forecast the weather?

Answers

Observational data collected by doppler radar, radiosondes, weather satellites, buoys and other instruments are fed into computerized NWS numerical forecast models. The models use equations, along with new and past weather data, to provide forecast guidance to our meteorologists

Answer:

Observational data collected by doppler radar, radiosondes, weather satellites, buoys and other instruments are fed into computerized NWS numerical forecast models.

Why does our sun appear to be bigger than all of the other stars?

A.The sun is much hotter than other stars.

B.The sun is the closest star to the earth.

C.The sun's color is yellow which is the brightest, most visible star.

D.As light travels from the other stars, it gets reflected.

Answers

B


Hope this helps (i can’t explain, because “B” is the explanation lol) :)
B like the other person said hahha

Gg x Gg
g
10.
G
GG
Gg
g
Gg
gg
The Punnett square above shows a cross between two plants. Both plants were heterozygous for dark green leaves (G)
and carry the recessive trait for light green leaves (g). In this cross, 50% of the offspring will be

Answers

Answer: Gg

Explanation:

Help plzzzz!!!!!!!???!!!!!

Answers

The answer is A.
As the population increases, so will deforestation. With deforestation, habitats will be destroyed leading to a decrease.

which statement best describes an example of selective breeding?​

Answers

Answer: the answer is A

Explanation:

how do radiation, conduction, and convection affect the atmosphere?​

Answers

Answer:

Conduction, radiation and convection all play a role in moving heat between Earth's surface and the atmosphere. Since air is a poor conductor, most energy transfer by conduction occurs right near Earth's surface. Conduction directly affects air temperature only a few centimeters into the atmosphere.

Explanation:

#KEEP LEARNING

true or false
Photosynthesis is part of an oak tree's niche.

Answers

Answer:

True, veryyyyy true

:))

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include

Answers

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.


PLEASE HELP !! If a person with a mass of 50 kg
and a person with a mass of 109
kg both jumped off a cliff, which
one will hit the ground with more
force? Remember: Gravity causes
things to accelerate at 10 m/s 2

Answers

Answer:

109kg? would hit the ground with more force

Explanation:

Im not sure if this is right but think of it like going down a hill, if your riding a bike with your dad who is 150 pounds and your 90 pounds, he will go faster. Sorry I just took a guess

PLEASE HELP WILL MARK BRAINLIST The group of animals (a pod of orcas) shown below is an example of What level of organization? Community Population Ecosystems Individual​

Answers

Answer:

The answer is likely population or community

Explanation:

the reason that it is not an ecosystem is because an ecosystem is more than just than group of animals itself it also includes the water and things growing underneath it. The reason that it is not an individual is because there is more than one there (a group).

8. Which is an example of a medium of communication?
in an office setting
letting people know that Fridays will not have casual dress
a formal speech at a meeting
a person objecting to a point that has been made

Answers

the answer is pier as

Proteins and polysaccharides are polymers. These polymers are formed by dehydration synthesis. Which statement correctly identifies a difference in the structure of proteins and polysaccharides? *
A. forming a variety of gametes that will pass on hereditary information

B. disrupting meiosis and the synthesis of amino acids into a sequence

C. producing the inorganic molecules needed for normal cell growth

D. directing the synthesis of proteins necessary for proper cell function

Answers

D. directing the synthesis of proteins necessary for proper cell function

I hope this helps a little.

where does mold come from?​

Answers

Mold is found everyone and can grow on almost any substance when moisture is presented. Mold could grow on non cellulose materials (plastic,metal, etc)

How does acid rain (deposition) form and travel to effect the environment?

Answers

Answer:

The ecological effects of acid rain are most clearly seen in aquatic environments, such as streams, lakes, and marshes where it can be harmful to fish and other wildlife. As it flows through the soil, acidic rain water can leach aluminum from soil clay particles and then flow into streams and lakes

Explanation:

True or false
processing maintains quality control .​

Answers

Answer:

True

(I am not 100% sure because the question is very short with no context, but I believe it to be true)

How does a human being get from one cell to one million cells?

Answers

Answer:

one cell???          cellular reproduction should be your answer I believe.

Explanation:

I need all of number 1 answered will give brainliest and 50 points I will give another brainliest and 50 points if you answer number 2

Answers

Answer: 1. ??? 2. I cannot read it

Answer:

What does it say?

Explanation:

If the carrot population increased, the rabbit population would:
NO LINK ANSWERS
A. increase
B. decrease
C. remain the same

Answers

Answer:

The rabbit population would remain the same as the increase in number of carrots doesn't determine / effect the population of rabbits.

Hope my answer helps !

Answer:

i believe the answer is c) remain the same

Explanation:

i say this because food availability wouldn't necessarily cause the population to grow (there would need to be an environmental change for this to happen.)

and the population wouldn't decrease because there would be an abundance of food and since starvation is one of the main causes of population decrease (along with over-crowding.)

good luck :)

i hope this helps

**please let me know if this was incorrect**

have a nice day!

What fossil is evidence that animals moved from living in the water to dry land? If u could help thanks!

Answers

Answer:

Tiktaalik roseae

Explanation:

The discovery of the fossil, Tiktaalik roseae on a Canadian island gives credence to the fact that animals moved from living in water to living on dry land. This fish which has feature of land animals such as a neck, skull, and ribs is believed to have lived some 375 million years ago. It also has features of fish such as the fins and scales.

The discovery of this fossil is important to scientists because it confirmed their believe that there should be an organism that would prove that life transitioned from water to land. The fossil was discovered in the year 2004.

which problem do you think contributes most to water scarcity?

Answers

Answer:

Agriculture consumes more water than any other source and wastes much of that through inefficiencies. Climate change is altering patterns of weather and water around the world, causing shortages and droughts in some areas and floods in others. At the current consumption rate, this situation will only get worse.

-WWF

Which of the following best describes physical science

Answers

Answer:

Do you have a list of answer options?

Explanation:

Answer: b. The study of matter and energy

Explanation:I got it right on the test

WILL GIVE BRAINLIEST TO BEST ANSWER NO LINKS Select the correct answer.
In 2002, Colorado was suffering from extreme drought. Which technology will help Colorado reduce the effects of future droughts?
A.
building sea walls
B.
building levees
C.
building dams
D.
building storm shelters

Answers

Answer:

Building dams is the technology that will help Colorado reduce the effects of future droughts.

Explanation:

i dont know why people are putting links up insted of awnsers. Have a nice day :)

Answer:

C. Building dams

Explanation:

dams can store and reserve water for future use (resevoirs)

Please help with this I’m being timed

Answers

Answer:

cell inhibitors

Explanation:

edge

Other Questions
What is the Bolivian word for "salt flats?" salantes salados sales salares Candice has 40 bows.She shared them with her two friends Cindy received and elsa received which one of her friend received more hair bows and by how many. Leticia bought a new tablet for $425.She had to pay a sales tax of 8%.What was the amount of sales tax she paid on the tablet? Sales Tax:$What was the total cost after sales tax that Leticia paid for the tablet? Total:$ the yellow company has a current ratio of 2.65 . The acid test ratio is 2.01 . The current liabilities of the are company $45,000 . Assuming there are no prepaid expenses the dollar amount of merchandise inventoey is Marlas mom bought a 36-pack of water bottles at the supermarket. Each bottle has 500 mL of water. How many liters of water is this?18363,60001,800 what is it known as when both the federal government and state government share a particular power? Express log6 (15) in terms of common logarithms *no file answers* who else has so much going on in there life that they find this part of them? OPLEAS HELP ILL GIVE BRAUINLIEST hey could someone explain this to me? your closet floor is 90 inches wide and 3 times as long what is the perimeter and area of your closet floor What is the radian measure of an angle of 75? Lab: Natural SelectionClaim Evidence Reasoning - Natural Selection LabActivePromptIf Mt. Kaboob were to erupt again, what changes might you expect to see in the walking bean population? a branch of alleges typically once studied in higher education Compare and contrast the frog's external anatomy with that of a mammal. State design advantages is has for its lifestyle. Which inequality best represents that ice cream at 3C is cooler than ice cream at 1C? Can yall help me on this ? How do the respiratory and circulatory systems work together to make gas exchange possible? plsss help asap edge 22) Which of the following was not promoted by Mahatma Gandhi:OA) NationalismOB) Caste systemC) DemocracyOD) Civil disobedience Steam Workshop Downloader