calculate the number of atom of each element : ​

Calculate The Number Of Atom Of Each Element :

Answers

Answer 1

Answer:

P = 6

O = 15

Explanation:

for the phosphorus you multiply the mole number which number of atom present, same thing applicable to the oxygen atom


Related Questions

What is independent variable

Answers

An independent variable is a variable that stands alone and isn’t changed by the other variables you are trying to measure.

Answer:

An independent variable is exactly what it sounds like. It is a variable that stands alone and isn't changed by the other variables you are trying to measure.

If the absolute temperature of the gas in a balloon is halved, by how much will its volume change?

Answers

Answer:

Volume also reduced to half

Explanation:

Volume and absolute temperature are directly proportional to each others

A sample of Nitrogen gas has a volume of 80.0 L at STP . If the temperature is held Constant what will the volume be at a pressure of 150 kPa?

Answers

Answer:

The final volume of the Nitrogen gas is 54.03 L.

Explanation:

Given;

initial volume of the Nitrogen gas, V₁ = 80 L

initial pressure of the Nitrogen gas, (at STP), P₁ = 101.3 kPa

final pressure of the Nitrogen gas, P₂ = 150 kPa

If the temperature is held constant, apply Boyle's law to determine the final volume of the Nitrogen gas.

V₁P₁ = V₂P₂

[tex]V_2 = \frac{V_1P_1}{P_2} \\\\V_2 = \frac{(80 \ L)(101.3 \ kPa)}{150 \ kPa} \\\\V_2 = 54.03 \ L[/tex]

Therefore, the final volume of the Nitrogen gas is 54.03 L.

How are mass and density different

Answers

Answer:

An object's density is the ratio of mass to volume of an object. The mass is how much it resists acceleration when a force is applied to it and generally means how much of an object or substance there is.

Answer:

brainleist

pls

Explanation:

An object's density is the ratio of mass to volume of an object. The mass is how much it resists acceleration when a force is applied to it and generally means how much of an object or substance there is.

J.J. Thompson in 1987, announced that cathode rays consisted of a stream
of ?
Hydrogen
Nuclei
Isotopes
Electrons

Answers

He announced that cathode rays consisted of a steam of Electrons.

For the reaction C+2H 2 —->CH 4 calculate the percent yield if 98 g of methane is produced when 100. g of carbon reacts with an excess of hydrogen?

Answers

The percent yield : 73.5%

Further explanation

Given

Reaction

C+2H₂⇒CH₄

Required

The percent yield

Solution

mol of Carbon(as a limiting reactant) :

[tex]\tt \dfrac{100}{12}=8.3[/tex]

mol CH₄ based on C, and from equation mol ratio C : CH₄, so mol CH₄ = 8.3

Mass of Methane(theoretical yield) :

[tex]\tt mass=mol\times MW\\\\mass=8.3\times 16=133.3~g[/tex]

[tex]\tt \%~yield=\dfrac{actual}{theoretical}\times 100\%\\\\\%yield=\dfrac{98}{133.3}\times 100\%=73.5\%[/tex]

Which of the following is composed mostly of ice?


Asteroids


Gaseous planets


Comets


Meteorites


Stars

Answers

Answer: The answer is C- comets!                                                                            

Explanation:  Callisto is composed mainly of rock and water ice, although other ices like ammonia ice and carbon dioxide ice may be present. Water ice occurs at the surface of Callisto so it would be comets.

i need help asap. which are the products?

Answers

Answer:

A

Explanation:

The products of a chemical equation is what is being experimented with. However, the results in which you get are known as your solution.

When the equations Na + O2 → Na2O is balanced the coefficient for O2 is
a) 1
b) 2
c) 3
d) 4

Answers

A) 1

4Na +O2 products to 2Na2O

The coefficient of oxygen gas (O2) in the following balanced equation is: 4Na + O2 → 2Na2O, is 1.

BALANCING EQUATION:

A balanced equation is an equation that contains the same number of atoms of each element on both sides of the equation.

Balancing a chemical reaction requires the use of coefficients, which are numbers placed in front of the elements/compounds involved.

According to this question, the following reaction is given:

Na + O2 → Na2O

The balanced chemical equation using coefficients is as follows:

4Na + O2 → 2Na2O

This balanced equation shows that 1 mole of oxygen is involved, hence, the coefficient is 1.

Learn more about coefficient of balanced equation at: https://brainly.com/question/21049751?referrer=searchResults

Conduction, convection and radiation can occur in variety of ways. Give another example, like the campfire picture above, where you have seen all three methods occur.

Answers

Answer: Boiling water

Explanation:


N204(0) + 2NO2(g)
Colorless Brown
Keq = 6.16 x 103
What is the predicted direction of change?

Answers

setup 1 : to the right

setup 2 : equilibrium

setup 3 : to the left

Further explanation

The reaction quotient (Q) : determine a reaction has reached equilibrium

For reaction :

aA+bB⇔cC+dD

[tex]\tt Q=\dfrac{C]^c[D]^d}{[A]^a[B]^b}[/tex]

Comparing Q with K( the equilibrium constant) :

K is the product of ions in an equilibrium saturated state  

Q is the product of the ion ions from the reacting substance  

Q <K = solution has not occurred precipitation, the ratio of the products to reactants is less than the ratio at equilibrium. The reaction moved to the right (products)

Q = Ksp = saturated solution, exactly the precipitate will occur, the system at equilibrium

Q> K = sediment solution, the ratio of the products to reactants is greater than the ratio at equilibrium. The reaction moved to the left (reactants)

Keq = 6.16 x 10⁻³

Q for reaction N₂O₄(0) ⇒ 2NO₂(g)

[tex]\tt Q=\dfrac{[NO_2]^2}{[N_2O_4]}[/tex]

Setup 1 :

[tex]\tt Q=\dfrac{0.0064^2}{0.098}=0.000418=4.18\times 10^{-4}[/tex]

Q<K⇒The reaction moved to the right (products)

Setup 2 :

[tex]\tt Q=\dfrac{0.0304^2}{0.15}=0.00616=6.16\times 10^{-3}[/tex]

Q=K⇒the system at equilibrium

Setup 3 :

[tex]\tt Q=\dfrac{0.230^2}{0.420}=0.126[/tex]

Q>K⇒The reaction moved to the left (reactants)

Answer:

The system will shift toward the products

The system is at equilibrium

The system will shift toward the reactants

Explanation:

This is correct on edg... Good Luck!!!!

A physical change is __________ if energy is given off.

Select one:
a. exothermic
b. endothermic
c. a chemical change
d. not possible

Answers

Answer:

A

Explanation:

2. What is the smallest unit of an organism that is classified as living? *
10 points
A. an atom
B. a molecule
C. an organ
D. a cell

Answers

Answer:

D

Explanation:

The cell is the basic structural, functional and biological unit of all known living organisms. Cells are the smallest unit of life that is classified as a living thing, and are often called the "building blocks of life.

Answer:

a cell

Explanation:

All living things are made of cells; the cell itself is the smallest fundamental unit of structure and function in living organisms.

Discuss in detail the role of various scientists in the discovery of electrons, protons and neutrons

Answers

Answer: The atom has three components the electrons, neutrons and protons.

Explanation:

J.J Thomson is responsible for the discovery of electron. He discovered the electrons while determining the properties of cathode rays in 1897. Rutherford is responsible for the discovery of proton during 1909 while performing the gold foil experiment. W. Bothe and H. Becker is credited to the discovery of neutrons.                          

What is the molecular formula of a compound that is composed of 94.1% O and 5.9% H with a molar mass of 34g

Answers

Answer:

H2O2

Explanation:

I know it's been awhile since the question was asked but for future people like me its H2O2 I got it right in the quiz.

The whole-number multiple is obtained by dividing its molar mass (34.02 g/mol) by the empirical formula mass. H₂O₂ is the molecular formula of a compound that is composed of 94.1% O and 5.9% H with a molar mass of 34g.

What is molar mass ?

The mass of a sample of a chemical compound divided by the quantity, or number of moles in the sample, measured in moles, is known as the molar mass of that compound. The molar mass of a material is a bulk attribute rather than a molecular one.

The mass of 6.022 × 10²³ atoms, molecules, or formula units of a material are equal to its molar mass, which is the mass of 1 mole of that substance represented in grams per mole.

Molar mass is a crucial factor to consider while planning an experiment. The molar mass enables you to calculate the quantity you should weigh out on your scale when testing theories that call for specified amounts of a material.

Thus, H₂O₂ is the molecular formula of a compound that is composed of 94.1% O and 5.9% H with a molar mass of 34g.

To learn more about molar mass follow the link;

https://brainly.com/question/12127540

#SPJ3

plzzzzzzzzzzzzz help i will mark you brainlest true orfalse/Air masses are responsible for the weather in a region

Answers

Answer:

True

Explanation:

Answer:

It is true!

I hope this helps. Have an awesome day <3

What is the mass of 5 moles of Fe2(CO3)3 ?

Answers

Answer:

1218.585

Explanation:

Looking at the subscripts we know there are 2 atoms of Fe, 3 atoms of C, and 6 of O.

Take the molar mass of each atom (from the periodic table) and multiply by the # of atoms

Fe: 55.845×2= 111.69

C: 12.011×3= 36.033

O:15.999×6=95.994

Add the values together: 243.717 g/mol

That is 1 mole of the molecule. Multiply by 5 for the final answer.

243.717×5=1218.585

Helpz me pleaz! I don't quite get it

Answers

Answer:

Al2O3

Explanation:

Al2O3 has an ionic bond because the bonds between them are very strong

KBr and Al2O3 it’s due to relative size of oxygen and aluminum and polarizing power of Al

Atoms of which element below are most likely to gain electrons?
Group of answer choices:

carbon

lithium

zinc

phosphorus

Answers

Answer:

Carbon and phosphorus

Explanation:

The atoms of carbon and phosphorus are most likely to gain electrons from the given choices .

The reason for this is because, both carbon and phosphorus are non-metals. Most non-metals usually accept electrons.

Metals are usually electron donors .

Metals are known for their electropositivity which is their ability to lose electrons. Non-metals are electronegative and will tend to have a strong affinity for electrons.

Convert the following word equation into a formula equation
fluorine + aluminum bromide → bromine + aluminum fluoride

Answers

Explanation:

Fluorine: F-

Aluminium: Al3+

Bromine: Br-

3F2 + 2AlBr3 => 3Br2 + 2AlF3

The balanced equation for the given chemical reaction can be given as

3F[tex]_2[/tex] + 2AlBr[tex]_3[/tex] [tex]\rightarrow[/tex] 3Br[tex]_2[/tex] + 2AlF[tex]_3[/tex]

What is balanced equation?

An equation for just a chemical reaction is said to be balanced if both the reactants as well as the products have the same number of atoms and total charge for each component of the reaction. In other words, both sides of both the reaction have an equal balance of mass and charge.

The products and reactants of a chemical reaction are listed in an imbalanced chemical equation, but the amounts necessary to meet the conservation of mass are not specified.

The balanced equation for the given chemical reaction can be given as

3F[tex]_2[/tex] + 2AlBr[tex]_3[/tex] [tex]\rightarrow[/tex] 3Br[tex]_2[/tex] + 2AlF[tex]_3[/tex]

Therefore, the balanced equation for the given chemical reaction can be given as

3F[tex]_2[/tex] + 2AlBr[tex]_3[/tex] [tex]\rightarrow[/tex] 3Br[tex]_2[/tex] + 2AlF[tex]_3[/tex]

To know more about balanced equation, here:

https://brainly.com/question/29769009

#SPJ2

Question 5 please thanks! Due in 4 Minutes xoxo!.

Answers

the answer would be B

the particles wouldnt break, nor would the form new particles or just disappear

Which one is correct? Please hurry, the audio is just reading the question!

Answers

I think it is D! Hope this helps

For the chemical reaction of ammonia combustion, write the expressions for velocity chemical reactions as a change in the concentration of all participants: 4 NH 3 (S ) + 5O 2 ( g )  4 NO ( g ) + 6 H 2 O ( g )

Answers

Answer:

See explanation

Explanation:

We define the rate of reaction as the rate of disappearance of reactants or the rate of appearance of products. The negative sign written before the rate of change of concentration of reactants shows that their concentration decreases with time.

The rate of reaction in terms of the concentration of each reactant or product is shown below;

Rate = -1/4d[NH3]/dt

Rate = -1/5d[O2]/dt

Rate = 1/4d[NO]/dt

Rate = 1/6[H2O]/dt

In the lab you react 23 g of potassium iodide with an excess of lead (II) nitrate to form 18 g of lead (II) iodide precipitate. What is the percent yield of your experiment?

A) 28
B) 56
C) 84
D) 98

Answers

Answer:

B) Percent yield = 56%

Explanation:

Given data:

Mass of potassium iodide = 23 g

Mass of lead iodide formed = 18 g

Percent yield = ?

Solution:

Chemical equation:

2KI + Pb(NO₃)₂    →     2KNO₃ + PbI₂

Number of moles of potassium iodide:

Number of moles = mass / molar mass

Number of moles = 23 g/ 166 g/mol

Number of moles = 0.14 mol

Now we will compare the moles of PbI₂ and KI:

                      KI          :           PbI₂        

                      2           :             1

                      0.14      :          1/2×0.14 = 0.07        

Theoretical yield of PbI₂:

Mass = number of moles × molar mass

Mass = 0.07 × 461 g/mol

Mass =  32.27 g

Percent yield:

Percent yield = actual yield / theoretical yield × 100

Percent yield = 18 g/ 32.27 g × 100

Percent yield = 56%

2. Explain how to determine the wavelength of a wave.
Type your answer here.
I

Answers

Answer:

Hope it helps:)

Explanation:

Wavelength can be defined as the distance between two successive crests or troughs of a wave. It is measured in the direction of the wave. This means the longer the wavelength, lower the frequency. ...

To find the wavelength of a wave;

The wavelength is calculated from the wave speed and frequency by λ = wave speed/frequency, or λ = v / f.

Replication, Transcription, and Translation Chart
Please answer


DNA Replication:

1。Template Strand: Start with this nucleotide chain.

TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC



2。Complementary DNA Strand: Write directly below template strand.


Transcription:

3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).



Translation:

4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).



5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).



6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).

Answers

I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.

Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC

Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG

mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG

Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG

(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop

How many molecules are in 13.2 g NO2?

Answers

Answer:

No. of molecules= mass/molar mass ×avogadro no.

                         =  13.2/50×6.02×10°23

  No. of molecules =1.59×10°23

Explanation:

what is the purpose of chemistry?

Answers

Answer:

To know more about chemicals and how to utilise them to solve man's probl

HELPPPPPPPPPPPPPPPPPP!!!!!!!!!!!!!!!!

Answers

Answer:

dalton

Explanation:

believe his first name is james, if your not to sure search it

I think the only answer it Rurherford

A group of students were discussing the lonization energies of Selenium and Flourine. Which student is correct for the reason why their element has the highest lonization energy? O A Student C says F because the larger the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction the more energy is needed to remove a valence electron. B. Student B says Se because the smaller the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction, the more energy is needed to remove a valence electron. C. Student D says F because the smaller the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction, the more energy is needed to remove a valence electron. OD. Student A says Se because the larger the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction the more energy is needed to remove a valence electron.​

Answers

I think the Answer is C because Flourine is stronger in electron attraction and is smaller so it has a stronger electronic pull. Hope this helps :)

Other Questions
The mean length of 6 childrens' big finger is 9cm. The mean length of 4 adults' big finger is 9.7cm. What is the mean length (rounded to 2 DP) of these 10 people's big finger? John states that the product of two real numbers is a real number. Extending this to imaginary numbers John states that the product of two imaginary numbers must be imaginary. Is his statement correct?I am having a hard time with imaginary numbers,please help. Althought it is renewable, water is considered a _______ resource.a limitedb disintegratingc negotiable Most homicides involve victims who are ______ and offenders who are _______ Which topic are you most likely to find in a physics textbook?A. photosynthesisB. electricity and magnetismC. metals and nonmetalsD. division of a living cellE. ionic, covalent, and metallic bonding Answer fast pleaseBrainliest for correct answer Choose the statement about responding to feedback during the revision process that is true.a. Writers should be open to constructive criticism about their writing.b. Writers should ask as many people as possible for feedback.c. Writers should fix spelling and grammar errors first, since they are most important.d. Writers should incorporate all feedback into their writing what two colonies which were proprietary colonies. What is the equation in slope-intercept form of a line that passes through the point (4, 5) and has a slope of 1/2? Read the objective summary of The Rights to the Streets of Memphis.The author is constantly hungry, so his mother gets a job outside the home. The author has to take over some chores, including grocery shopping. After bullies beat him up and steal his money, his mother gives him a stick and tells him to stand up to them. Though the author is scared, he becomes angry and fights off the bullies, and they dont bother him anymore.Which important detail should be added to this summary?The author eats a crust of bread or drinks a cup of tea to stop his hunger.The authors mother gives him more money and another grocery list.The author cries and stammers when he runs home from the bullies.The authors father left the family with nothing. what is the slope represented in the table?????? Hello!Can someone please translate this?picture is given!... List and explain at least 3 events that occurred under Napoleon and describe the goals of the Congress of Vienna. find the mean of given data 32,41,28,54,35,26,23,33,38,40. Divide. Write the answer in simplest form 2 1/2 8 which web design concept is most closely related to elements that symbolize the real world Please helpppppppppp Student council wants to paint a mural of the school mascot on a wall in the gym. The scale 1 inch represents 2.5 feet is used in their plan the mascot will be 10 feet tall in the actual mural how tall is the mascot on the plan in inches WILL GIVE BRAINELIEST ( dont know how to spell it lol) Temperature can be measured in degrees Celsius (C). A temperature of 0C is the freezing point of water. Which statements are true?Select all correct answers.A temperature of 10C is colder than 12C.A temperature of 10C is colder than 12C.When the temperature is 70 above freezing, the temperature is 70C.When the temperature is 70 above freezing, the temperature is 70C.A temperature of 16C is colder than 12C.A temperature of 16C is colder than 12C.A temperature of 8C is colder than 12C.A temperature of 8C is colder than 12C.A half degree above the freezing point is a negative number.A half degree above the freezing point is a negative number.When the temperature is 7 below freezing, the temperature is 7C. Bill Moyers served on the staff of president____.1. Lyndon B. Johnson2. Bill Clinton3. Ronald Reagan4.George H. W. Bush Steam Workshop Downloader