A person is admited into the hospital an unknown ailment. The patient is seen by Triage and immediately put on intravenous liquid or more commonly known as an IV by a brand new nurse
Unfortunately for the patient the nurse did not property prepare the IV and hooked the patient to an IV fluid line consisting only of distilled water.

What will mostly likely occur to this patient’s red blood cells if the IV dispenses its contents in its totality?

A) The environment in the patient’s blood will be isotonic if the cells and their environment have reached equilibrium, cells will remain the same size.

B) The environment inside and outside the patient’s cells will be isotonic and may cause the cells to burst.

C) The environment around the patients cells will be hypotonic and cause the cells to shrink.

D) The environment inside the patient’s cells will be hypertonic and may cause the cells to burst.

Answers

Answer 1
answer: c
explanation:

Related Questions

Dependence and Addiction are the
same thing?
a. True
b. False​

Answers

Answer:

b

Explanation:

one is a necessity, the other is a struggle

Which theory suggests all living things are made up of a cell or cells? cell theory organismal theory

Answers

Answer:

Cell theory

Explanation:

The unified cell theory states that: all living things are composed of one or more cells; the cell is the basic unit of life; and new cells arise from existing cells.

which statement best describes the forces in the picture?
a. The applied force in the force of friction are balanced.
b. all four forces are the same size.
c. all four forces are acting in the same direction.
d. The applied force in the force of friction are unbalanced.​

Answers

Answer: Its A.

Explanation:

None

The applied force and the force of friction are balanced in the picture because of which the person is standing still. Therefore option (A) is correct.

What is force?

A change in the force that is applied to an item with mass will cause that thing to move at a different speed. A body's state of rest or motion can be altered by the application of an external agent known as force. It is significant in both magnitude and direction.

The term "frictional force" refers to the force that is produced when two surfaces come into contact with one another and then slide against one another. A few factors that affect the force of friction are as follows: These forces are primarily influenced by the surface texture as well as the amount of force that is drawing them closer together.

Learn more about force, here:

https://brainly.com/question/13014979

#SPJ5

The field of Astronomy is not related to technology
O True
False

Answers

Answer:

false

i hope this helps and goodluck!

What field of forensics do medical coroners work in?
O Forensic sociology
O Forensic pathology
O Forensic entomology
O Forensic psychiatry

Answers

the answer should forensic pathology :) my apologies if wrong but that should be it

Answer:

THE ANSWER is B

Explanation:

i need to poop

Consider the plant cells in the image below. What is a function of the cell structure that is labeled x?

Answers

Answer:

c) It provides support to the plant

Answer:c

Explanation:

Which of the following is a term use to describe a mound, hill of ridge of wind-blown sand?
A.peak
B.hill
C.contour
D.dune​

Answers

The answer is D.dune

Example of reproduction

Answers

Answer:

a deer giving birth to a baby deer


What problems can pseudoscience cause for society?

Answers

Answer:

It is quite difficult to picture a pseudoscientist—really picture him or her over the course of a day, a year, or a whole career. What kind or research does he or she actually do, what differentiates him or her from a carpenter, or a historian, or a working scientist? In short, what do such people think they are up to?

… it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.

The answer might surprise you. When they find time after the obligation of supporting themselves, they read papers in specific areas, propose theories, gather data, write articles, and, maybe, publish them. What they imagine they are doing is, in a word, “science”. They might be wrong about that—many of us hold incorrect judgments about the true nature of our activities—but surely it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.

Cells are the basic unit of life. Some cells are single-celled organisms and others
are specialized to do a specific function for an organism. Even though cells are
structurally different depending on the organism, all cells have this in common?
A. The presence of nucleic acid
B. The absence of a nuclear envelope
C. The presence of a cell wall
D. The absence of ribosomes

Answers

Answer:

A. The presence of nucleic acid

Explanation:

A cell membrane has permeability, which means that the membrane:

Answers

Answer:

transport proteins are specific and selective for the molecules they move, and they often use energy to catalyze passage.

Explanation:

I barley know what your trying to say

science is so confusing to me!

Select all answers that are correct.

If people have never observed matter (mass) to be created or destroyed, then using inductive reasoning, it would be logical to conclude that:


the known laws of science cannot account for the origin of mass
the amount (quantity) of mass in the universe has never changed
the mass of the universe must have created itself

Answers

Answer:

second one.

Explanation:

not sure but it's the only answer that goes with the other laws

NEED ASAP


Which quality would make the question "What will make cows produce more milk?" a good scientific question for a
biologist to investigate?
A) It is about living things and is testable.
B) It will help consumers save money.
C) It will lead to new technology to gather milk.
D) It is a question that can have many answers.

Answers

Answer:

D

Explanation:

The scientist could find new tech, which could lead to lower prices, also, it is about living things and testable, so it would be many answers.

At what temperatures can monarch fly?

Answers

Answer:55 degrees

Explanation:In order for an adult monarch to fly, temperatures need to be above 55 degrees Fahrenheit.

Answer:

Temperatures need to be above 55 degrees Fahrenheit.

Explanation:

Write a one-paragraph essay that summarizes the relationship between chloroplasts and
chlorophyll, making sure to include how they work together in photosynthesis.

Answers

Answer:

New algorithms for estimating chlorophyll-a in the Spanish waters of the Western Mediterranean Sea from multiplatform imagery This manuscript proposes a set of multi-sensor chlorophyll-a empirical algorithms for improving current estimates of chlorophyll-a concentration in two distinct regions in the Mediterranean Sea.

Many studies in the area of cancer research are opening up new possibilities for cures and prevention measures.  One area of research is directed at the effects that chlorophyll may have on cancer cells within the human body.  Research is being conducted to investigate whether chlorophyll has important cancer fighting factors that may play a role in the destruction of cancer cells or whether it is an effective preventive agent.  

Daily supplements of the chlorophyll derivative, chlorophyllin (CHL) can provide a way to prevent cancer by reducing DNA damage  (Arbogast, 1995).   The chlorophyllin copper complex (CHL) is a water-soluble version of chlorophyll and is a semi-synthetic prepared substance.  CHL is the most common chlorophyll derivative used for cancer related studies  (Chernomorsky, 1999).  Most research was done using chlorophyllin because chlorophyll is chemically modified to chlorophyllin in the body during digestion. Chlorophyllin given in amounts to that of chlorophyll were equally effective in the studies  (Sarkar, 1994).  CHL can be added to the diet very easily and may be safe and useful for effective prevention of cancer  (Arbogast, 1995).

Explanation:

Hope this is what you wanted.

Which of the following is an example of a complex machine?
1. Pulley
2. Wedge
3. Scissors
4. Incline

Answers

3- Scissors are an example of a complex machine.

Answer:

A :3

Explanation:

Just did acceleratted ed. Hope this helps!

Explain the law's of segregation and independent assortment.

Answers

Answer:

The law of segregation states that the two alleles of a single trait will separate randomly, meaning that there is a 50% either allele will end up in either gamete. This has to do with 1 gene. The law of independent assortment states that the allele of one gene separates independently of an allele of another gene.

Explanation:

I know it late but can u plz mark me brainliest?

please help me, 50 points

What type of bond are the arrows pointing to below in the picture


Answers

Thats is euther hydrogen bond or oxyegn bond. Im leaning towards hydrogen bond

What’s the answer ????????

Answers

it’s d
i looked it up and it’s the exact same:)

Answer:

D: Electrons are transferred from one atom to another.

Explanation:

Protons are not involved in the covalency, and C, electrons are shared between two atoms, is the definition of a covalent bond, such as water. Ionic bonds form when two atoms, share (transfer) electrons to one another in order to fill the outer electron ring.

Hope this helps!

why did samy say the f word i told him so many times and still says it

Answers

who is samy? and i’m so confused please explain more

Question 6 of 20
A girl swings a yo-yo around in circles. How can she increase the total energy
of this system?
O
A. Reverse the direction of the swing,
O
B. Stand on a table while swinging the yo-yo.
C. Sit on the ground while swinging the yo-yo.
о
D. Swing the yo-yo at a lower speed,
SUBMIT

Answers

Answer:

it's B

Explanation:

A girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.

What is Yo-yo?

Yo-yo may be defined as a type of toy that consists of a pair of joined discs with a deep furrow between them in which thread is attached and wound.

By reversing the direction of the swing, swinging the yo-yo at a lower speed, and sitting on the ground while swinging the yo-yo decrease the total energy of the system. This is because the system does not have the momentum that is required to increase its overall energy.

Therefore, a girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.

To learn more about Total energy of the system, refer to the link:

https://brainly.com/question/478253

#SPJ5

Choose one carbon sink and explain how the carbon gets out of it.

Answers

Answer::

Explanation:

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC


Highlighted letters are: ATACTACC

Answers

Answer:

1 and 5

Explanation:

https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question

Answer:

1.ATTAGC(ATACTAC)GGGC

5. ATGAATGC(ATACTACC)GGGC

In the outer layer of the sun, energy is transported outward by the rising of hot plasma and sinking of cooler plasma. This transfer is known as

Answers

Answer: Convection.

Explanation:

We have 3 types of heat transmission.

Radiation: Heat is transported as electromagnetic waves, this is not the case shown here.

Conduction: When we have two objects with different temperatures and we put them in contact, the system will want to go to equilibrium (both objects have the same temperature) so the hot object will give heat to the cooler object. We usually see this with solid objects.

Convection: It is the heat transfer due to the bulk movement of the molecules, so this need a material medium (it can not take place in solids, because the position of the molecules is fixed in the solids).

Then the rising of hot plasma and sinking of cooler plasma is convection.

A location's weather depends on...
Question 1 options:
A. temperature
B. clouds
C. precipitation
D. all of the above

Answers

Answer:

D

Explanation:

its obvious

Answer:

D all of the above

Explanation:

The temperature is the heat or cold in the weather.

The clouds can change the temperature in the weather.

Precipitation is what most people think of when you say weather.

Please put the following in order from Least Inclusive to MOST inclusive...

Organs Molecules Organ Systems
Organism Cells Tissue

A) Organism -> Organ Systems -> Organs -> Tissue -> Cells -> Molecules
B)Atoms -> Cells -> Molecules -> Organs-> Organ Systems -> Organism
C) Molecules -> Cells -> Tissue -> Organs -> Organ Systems -> Organism
D) Cells -> Organism-> Tissue -> Organ Systems -> Molecules -> Organs

Answers

Definitely C. A has it reversed, B includes atoms and puts molecules after cells, and D puts organisms right after cells

what are thylakoids? I will give BRAINLIEST!!

Answers

Answer:

each of a number of flattened sacs inside a chloroplast, bounded by pigmented membranes on which the light reactions of photosynthesis take place, and arranged in stacks or grana.

Thylakoids are membrane-bound compartments inside chloroplasts and cyanobacteria. They are the site of the light-dependent reactions of photosynthesis. Thylakoids consist of a thylakoid membrane surrounding a thylakoid lumen. Chloroplast thylakoids frequently form stacks of disks referred to as grana.

Explanation:

Answer:

They are membrane-bound compartments inside chloroplasts (the food producers of the cell) and cyanobacteria (group of photosynthetic bacteria).

Match each mineral property to the correct description.
crystal system
the ability to attract certain metals
cleavage
the number and angle of crystal faces
magnetism
the ability of a mineral to break along flat
surfaces
fracture
an irregular way of breaking apart
fluorescence
the ability to produce a visible glow

Answers

Answer: here you go hope this helps

Explanation:

Matching each mineral property to the correct description is:

crystal system

the number and angle of crystal faces

cleavage

the ability of a mineral to break along flat surfaces  

magnetism

the ability to attract certain metals

fracture

an irregular way of breaking apart

fluorescence

the ability to produce a visible glow

A mineral property are those things that make up or characterize a mineral. For example, things like crystal forms, luster, color, etc are all ways to recognize a mineral.

Read more here:

https://brainly.com/question/6736830

What are the differences between the Big Bang Theory and the Steady State Theory?

Answers

Answer

One is a move and the other is a part of a state.

Explanation:

Answer:

The only difference, he explained, was that in the big bang scenario all the matter was created in one explosive beginning.

Which of the following is caused by bad genes? *

Carcinoma
herpes
athlete's foot
vitaligo
bubonic plague

Answers

The answer is Vitaligo because all of the other answers are ones that you develop and not something you’re born with
Other Questions
WILL GIVE BRAINLIEST!!!!!Louis XIV tried to bolster the economy with this finance minister, who put high tariffs on imported goods and encouraged colonies overseas.Louis XVJean Baptiste ColbertCardinal RichelieuChristopher Columbus Represented by whom? No one you! It is an affront to democracy to suggest that just because you understand how life works in Austin, you should be able to call the shots for the rest of us. HELP PLEASEEEE!!!!! [Easy] Write an equation for the description.Tanmayi wants to raise $150 for a school fundraiser. She has raised $100 so far. How much more does sheneed to reach her goal? Let m be how much more is needed. Plzzzzzz helppppp Elements in the same group on the periodic table have the same number of valence electrons, but elements in the same period will increase the number of valence electrons by one from left to right on the periodic table. TRUE OR FALSE After 4 days Gianna made 215 cookies. After 6 days she made 275 cookies. How many cookies would Gianna make after 10 days? In Cherokee County, the fine for speeding is $17 for each mile per hour the driver is traveling over the posted speed limit. In Cherokee County, Kirk was fined $221 for speeding on a road with a posted speed limit of 30 mph miles per hour. Kirk was fined for traveling at what speed, in miles per hour? 10. Name 2 countries invaded by Germany during the period of 'appeasement' whereby GreatBritain and France did nothing and chose not to respond to German aggression. About how long ago did our solar system start to form?O About 5 million years agoO About 14 million years agoO About 5 billion years agoAbout 14 billion years ago The metal day fair has a recycling center that will a pay 10% early fee on the amount collected plus $2.75 for each metal collected to be recycled .If Isa brings 12.5 kilograms of metal to be recycled which is the closet amount of money she will receive. If RS+TU=XY and TU=WV, then RS+WV=XYChoose the definition, theorem, or postulate that justifies the statement. A. Subtraction Property of EqualityB. Definition of MidpointC. Segment Addition PostulateD. Symmetric Property (of= or)E. Reflexive Property (of= or)F. Transitive Property (of= or)G. Definition of CongruenceH. Substitution PropertyI. Addition Property of EqualityJ. Multiplication Property of EqualityK. Division Property of Equality Read the excerpt from an adaptation of "To Build a Fire. After a time a stinging sensation returned, and the man stripped the mitten from his right hand, fetched forth the birch-bark, and brought out his bunch of sulphur matches. But his hand had already gone numb again, and in his effort to separate one match from the others, the whole bunch fell in the snow. How does the setting affect the plot in this excerpt? The unfamiliar land makes it challenging for the man to find his way. The blanket of snow makes it impossible for the man to stay dry. The extreme cold makes simple survival steps difficult to perform. The tree cover makes it difficult to determine the time of day. Stonebridge neighborhood garage sale have the cash receipts for 5 days:$136.97$256.21$366.10$176.04$72.49 Ill mark brainliest!!!! What is the length of BC in the right triangle below?A. 63. 3. 21D. -/63E. 15 225 e) She is ............. useful member of our team( a, an, the,Nothing)f) Fan is hangingceiling (in,on, to) I have plenty of dreams, but the reality is that we'll have to stay here until the war is over. We can't ever go outside, and the only visitors we can have are Miep, her husband Jan, Bep Voskuijl, Mr. Voskuijl, Mr. Kugler, Mr. Kleiman and Mrs. Kleiman, though she hasn't come because she thinks it's too dangerous.The Diary of a Young Girl,Anne FrankWhich word best describes the mood of this passage?a- hopelessb- solemnc- excitedd- terrified PLEASE HELP IM RUNNING OUT OF TIME! If I wanted to say I listen to music here and there would I say Ich musik hre ab und zu or Ich hre musik ab und zu Which lists all the multiples of 6 that are less than 20?O 6,9,12,15,18O 6.12O 6.12.18O 6, 12, 18, 24 A table of equivalent ratios is shown. One value is missing from the table.Which value is missing from the table?a.) 8b.) 9c.) 11d.) 13 A farmer notes that in a field full of horses and chickens there are 35 heads and 98 feet. How many of each animal are there? Steam Workshop Downloader